Лекарство от поноса у поросят


что делать, чем и как лечить диарею в домашних условиях?

Диарея у свиней — тревожный симптом, который нельзя игнорировать. В тяжелых случаях это может привести к гибели всего стада.

Поэтому каждый фермер должен знать проявления и возможные причины расстройства пищеварения, а также способы лечения. Особенно опасно, если понос у поросят первых недель жизни.

Чем опасна диарея у поросят и свиней?

Лечить понос у поросенка нужно обязательно, это не та проблема, которая бесследно уйдет сама. Диарея – опасное состояние, способное, в некоторых случаях, привести к падежу не только молодняка, но и всего поголовья взрослых свиней.

Важно! Понос – это не болезнь, а только симптом какого-то отклонения в работе организма. Перед тем, как лечить у поросенка расстройство желудка, нужно выяснить его причину.

Диарея очень коварна, ведь всего за несколько часов она может привести к гибели маленького поросенка. Состояние это тем опаснее, чем меньше масса животного: малыши погибают очень быстро. На спасение взрослой и сильной свиньи от поноса у фермера, как правило, есть несколько суток.

Сильный понос, усугубленный рвотой и высокой температурой, приводит к быстрому выведению жидкости из организма. Вместе с водой тело поросенка покидают ценные соли и минеральные вещества, без которых невозможна работа жизненно важных органов (сердца, нервной системы, мозга).

Именно обезвоживание, в паре с интоксикацией, становится причиной массового падежа свиней. Лечение поноса на первых этапах должно быть направлено на восстановление солевого и щелочного баланса в организме поросенка.

Почему поносят?

Диарея у поросят характеризуется частым опорожнением кишечника. Каловые массы имеют жидкую консистенцию, могут содержать слизь, пену, кровянистые сгустки, вкрапления.

Понос может быть у новорожденных, подросших особей, у взрослых свиней.

Важно! Если диарея появилась у поросят, которые постоянно питаются молоком свиноматки, нужно сразу назначить лечение. Как правило, больных сосунов в помете несколько.

Основной причиной расстройства желудка у поросят, взрослых животных можно назвать погрешности в питании, несбалансированный, некачественный рацион.

Диарея у поросят может возникнуть также при резкой смене режима, типа питания, кормления протухшими, некачественными комбикормами.

Если поросята поносят, среди возможных причин можно выделить:

  • отсутствие должной гигиены в помещениях, в которых содержатся животные;
  • отравление ядовитыми веществами, семенами растений;
  • глистные инвазии;
  • заразные, незаразные болезни;
  • переохлаждение организма, недостаточный температурный режим в свинарниках;
  • гипо-, авитаминоз;
  • врожденные, приобретенные патологии органов ЖКТ;
  • нарушение метаболизма.

Диарея у поросят часто указывает на то, что они заражены какой-либо инфекцией, вирусным, бактериальным, паразитарным заболеванием. Понос у свиней также может возникнуть из-за переедания, поедания ядовитых растений.

Новорожденные

При поносе у поросят-сосунов отмечают частое интенсивное выделение водянистых каловых масс. Поскольку диарея у новорожденных малышей — явление относительно нечастое, причина подобного состояния кроется в кормящей свиноматке.

Возможно, она инфицирована вирусами, бактериями, внутренними паразитами, которые провоцируют кишечные инфекции, особенно в том случае, если она часто отлучается от своего выводка.

Если поросята запоносили, это может быть спровоцировано также тем, что рацион кормящей свиноматки состоит из большого количества грубых, твердых кормов.

Некоторые виды трав, растений, которые поедает свинья, также могут привести к расстройству желудка у малышей. Большое количество молока часто вызывает диарею у сосунов.

У сосунов

У поросят сосунов диарея связана со следующими факторами:

  • Мастит у свиноматки, который привод к изменению качественных характеристик молока. В этом случае необходимо лечение матери. У выводка проводится симптоматическая терапия.
  • Недостаток молока приводит к нехватке питательных веществ и расстройству стула.
  • Охота свиноматки. Спустя неделю в крови матери может снижаться уровень пролактина – гормона отвечающего за выработку молока. Снижение его концентрации также приводит к росту полового влечения: свиноматка становится беспокойной.
  • Повышенная жирность молока значительно разжижает стул поросят. Для нормализации состава необходимо подобрать специальный режим питания для матери.
  • Холод в помещении.

Подросшие

У подросших поросят в возрасте 2–3 месяцев диарея — довольно частое явление. Расстройство желудка может быть спровоцировано самыми различными факторами.

В возрасте нескольких месяцев малыши ведут подвижный, активный образ жизни. Если поросят выпускают на выгул, они могут подхватить кишечную инфекцию, заболевания от других домашних животных, птиц, грызунов.

Очень часто причиной диареи у поросят являются вирусно-бактериальные болезни, которые представляют опасность не только для здоровья, но и для жизни животных. Заражение может произойти контактным, алиментарным, эрогенным путем.

Подцепить инфекцию свинки могут от скрытых вирусоносителей. Если на фоне диарее заметна другая побочная симптоматика, необходимо срочно предпринять соответствующие меры, начать лечение.

Если понос у маленьких поросят не является симптомом инфекций, заболеваний, расстройство желудка могут спровоцировать жаркие погодные условия. Сильный перегрев, как и переохлаждение, очень негативно сказывается на работе органов пищеварительного тракта.

У подросших поросят понос может быть вызван перееданием. Маленькие свинки ведут подвижный образ жизни и если сильно проголодаются, начинают жадно поедать пищу.

Плохо измельченные, грубые корма провоцируют расстройство желудка у этих животных на несколько дней. Чем лечить в домашних условиях понос у поросят, подскажет ветврач, поскольку терапия, дальнейшие действия зависят от первопричин, которые спровоцировали подобное состояние.

Симптомы диареи

Признаки Болезнь
Водянистая консистенция кала Нарушения в работе кишечного тракта
Пенистые испражнения с запахом гнили, сухость кожных покровов, повышенная температура Заражение болезнетворными бактериями
Жирные, серые фекалии Нарушения в работе ЖКТ
Желтоватый или зеленоватый кал, кислый, тухлый запах Пища плохо усваивается в тонком кишечнике
Испражнения светлее обычного Организм вырабатывает мало желчи
Снижение аппетита, выделения из ушных раковин и глаз, сухость кожи, рвота, высокая температура, иногда — кровь в моче, чрезмерное возбуждение или угнетение, судороги, одышка, паралич Отравление
То же, плюс кашель, хрипы, потеря веса, почесывания, самоизоляция от остального стада, иногда — повышение агрессии Глистная инвазия
Черный цвет фекалий Кровотечение в органах ЖКТ

Если поросята поносят, основной признак — частый, жидкий стул водянистой, кашицеобразной жидкой консистенции.

В каловых массах, которые могут литься неконтролируемо, часто присутствует слизь, пена, кровянистые нити, сгустки, вкрапления, остатки непереваренного корма.

Основная опасность при расстройстве желудка у поросят заключается в функциональных нарушениях в работе ЖКТ, других органов и систем, а также в быстром обезвоживании организма.

На фоне диареи может развиться другая побочная симптоматика, физиологические нарушения, изменения в метаболизме.

Важно! Определить причину диареи можно по цвету, консистенции, общему виду каловых масс.

Белый стул указывает на поражение печени. Пенистая диарея — частый симптом глистных инвазий, вирусных заболеваний. Черный, кровавый, бурый понос сигнализирует о возможных кровотечениях в органах ЖКТ.

Специфически резкий гнилостный запах, исходящий от каловых масс, — симптом брожения в кишечнике.

Поросята теряют вес, нет прироста живой массы. Животные слабеют, становятся малоактивными, ложатся на бок. Отмечают снижение либо полное отсутствие аппетита. Возможна рвота, тошнота, повышенная жажда.

Если помимо диареи у поросят заметны другие клинические симптомы, нужно незамедлительно связаться с ветврачом. Специалист после диагностики подберет эффективное лечение.

Лечение в домашних условиях

При поносе у поросенка нужно определить причину подобного состояния. Чтобы не спровоцировать серьезных физиологических нарушений, лечение диареи должно быть комплексным.

Чаще всего животным назначают медикаментозное лечение. При этом запущенную стадию лечить гораздо труднее. При поносе у поросят лечение нужно проводить в первый день, особенно, если есть подозрение на инфекцию.

Если понос не спровоцирован инфекцией, пересмотрите рацион питомцев, обеспечьте оптимальные условия содержания, проведите дезинфекцию в помещениях, где содержатся животные.

Если диарея у поросят-сосунов вызвана несбалансированным рационом матери, давайте свиноматке меньше твердых, грубых кормов. Следите за тем, чтобы лактирующая свинка не контактировала с другими домашними животными.

Поросятам дают лекарство, медикаментозные средства, действие которых направлено на снижение моторики кишечника, улучшение, нормализацию пищеварительных процессов. При поносе у поросят лечение совмещают с другими профилактическими мерами.

Лечение будет эффективным при соблюдении оптимального баланса микроэлементов и солей в организме животных. Поросятам дают хлористый калий (10%) 3 раза в день по 10 мг. Его можно заменить 1%-ным раствором поваренной соли в расчете 5 г на 500 мл воды.

Поросятам-сосунам можно давать обволакивающие растворы, пробиотики, ферментные средства. Можно дать 0,9%-ный раствор натрия хлорида, который поможет устранить признаки обезвоживания.

В дополнение к основному лечению проводят ферментотерапию. Это даст хороший эффект при нарушении процессов пищеварения.

Опытные фермеры дают подкисленную лимоном воду (1 мл на литр воды), Регидрон, другие адсорбенты.

Важно! Давать лекарственные средства лучше всего поросятам натощак.

Если это не дало положительных результатов, при диарее, вызванной инфекциями, вирусными заболеваниями животным назначают антибиотики, сульфаниламиды.

Из медикаментов при диарее поросятам назначают:

  • Бровасептол. Выпускается в виде порошка, который подмешивают и дают вместе с пищей из расчета 3–4 г на кг корма. Лечение занимает пять суток.
  • Бровафом. Представляет собой хорошо растворимый в воде порошок. Можно добавлять в комбикорма (1 кг лекарства на 500 кг комбикорма).
  • Биовит. Ветпрепарат содержит необходимый для нормального пищеварения витамин В12, антибиотик гидрохлорид тетрациклина. Нужно давать лекарство поросенку раз в сутки. Продолжительность лечения — 6–7 дней. Если возраст поросят до 10 суток, то расчет проводят, исходя из 15 г препарата на 10 кг веса. Если малышам от 1 до 2 месяцев, то дают по 6 г на 1 кг веса, а 4-месячным нужно давать по 15 грамм препарата.
  • Аколан. Это монопрепарат на основе антибиотика колистина. Показан при инфекционных болезнях ЖКТ. Средство выпускается в виде порошка для разведения в воде. Раствор дают поросятам с водой или молоком в дозе 1 г/кг веса дважды в сутки. Терапию продолжают 3 суток. Активное вещество выводится за 24 часа.

В случае подозрения глистных инвазий используют такие лекарственные средства: Альбен; Ивермек; Нилверм. Одни средства обладают широким спектром действия, другие эффективны против отдельных видов паразитов.

Поэтому назначать препарат должен только ветврач после установления типа глистов.

Народные средства

Вылечить диарею у маленьких поросят можно народными средствами. При этом не забудьте проконсультироваться с ветврачом, чтобы избежать возможных осложнений.

Расстройство желудка поможет устранить рисовая болтушка, водно-спиртовая настойка хвои, отвар ромашки, зверобоя, коры дуба, череды.

Дайте больной свинке корень цикория (50 г на литр воды), настойку крапивы двудомной в пропорции 1/1, крепкий настой из правильно высушенного сена.

Целебные растения используют из расчета 40 г на литр воды. Добавляют в поилки, заменив обычную питьевую воду.

От поноса поросятам очень хорошо помогает рисовая болтушка. Чтобы ее приготовить, возьмите 1 кг риса, проварите крупу в 10 литрах воды. Слейте лишнюю воду. Давайте поросятам по 100 г болтушки четыре раза в сутки.

Если у поросенка сильный понос, в аптеках можно приобрести хвойную вытяжку. Опытный фермер дает больному животному по 2 мл трижды в сутки.

Заливают в глотку поросенку при помощи шприца без иглы или большой ложкой. Если этого мало, можно увеличить дозу до 3 мл, но только подросшим поросятам, взрослым свинкам. Данная настойка поможет быстро устранить расстройство желудка.

Пошаговая инструкция по приготовлению домашнего аналога Регидрона:

  • Кипятят 1 литр воды;
  • Дают воде остыть до 40-50 °С;
  • Всыпают 1 столовую ложку сахара;
  • Всыпают 1 столовую ложку соли;
  • Перемешивают, пока кристаллы полностью не растворятся;

Также, одним из способов борьбы с поносом есть взболтанные куриные сырые яйца, так называемый гоголь-моголь, который может дать положительный эффект, но только на начальном этапе.

Терапия при подозрении на отравление

При отравлении выясняют, какое именно вещество стало причиной недомогания. ЖКТ промывают, дают противоядие — например, Унитол. Этот препарат эффективен против мышьяка, висмута, других тяжелых металлов. Исключение составляет свинец.

Применяют адсобренты, мочегонные, общеукрепляющие средства. При отравлении солью показаны внутримышечные инъекции глюконата кальция.

Интоксикацию нитритами и нитратами лечат раствором метиленового синего с глюкозой, препарат вводят внутривенно.

Вьетнамские поросята

У вьетнамских поросят У представителей данного вида функционирование ЖКТ несколько отличается от других пород, в связи, с чем понос у маленьких поросят лечится другими препаратами:

  • Тетрациклином или Левомицетином, которые назначаются в дозировке от 35 мг/кг массы животного;
  • Фармазин 50 мг предназначен для внутримышечного введения;
  • Фуразолидон назначается исходя из пропорций по 3 мг на каждый килограмм массы животного.

Рассмотрев, как лечить диарею у маленьких поросят, можно быстро нормализовать состояние больных животных. Главное — правильно определить причину подобного состояния и как можно быстрее начать соответствующее комплексное лечение.

Меры профилактики

Особое внимание уделяют питанию самых младших членов поголовья. Новые продукты вводят в рацион осторожно. Затем ждут несколько дней, наблюдая за реакцией организма. Кормления проводят в одни и те же часы.

Чтобы у маленьких поросят не возник кровавый понос, пищу измельчают и перемешивают. Особенно это касается вьетнамский свиней, желудочно-кишечная система которых не способна переваривать слишком грубую пищу.

Если в рационе уже присутствует трава, то нельзя давать ее сразу после покоса. Сначала зелень немного привяливают, и только после этого кладут в кормушки. В таком виде продукт лучше переваривается и не приводит к расстройствам пищеварения.

На подворье, где выгуливаются свиньи, не должно быть ядовитых трав. К ним относятся:

  • вех ядовитый;
  • дурман;
  • чемерица;
  • лютик;
  • паслен;
  • горчица.

Корма всегда должны быть свежими, без признаков гниения и плесени. Нельзя оставлять влажные мешанки дольше, чем на 2–3 часа. Перед каждым приемом пищи емкости для корма очищают от остатков пищи и загрязнений.

3 раза в месяц кормушки и поилки обдают кипятком. Сразу после появления на свет поросят выпаивают теплой прокипяченной водой. В нее добавляют марганцовку, чтобы получился бледно-розовый раствор.

Не менее полезны отвары злаков — овса, риса, а также семян льна. В свинарнике регулярно убирают. Влага, грязь, холод способствуют распространению инфекционных заболеваний.

Каждый год стены белят известью. Дважды в неделю загоны подлежат дезинфекции. Подстилку меняют ежедневно. Периодически поросятам дают витаминные комплексы и рыбий жир.

Для предупреждения диареи и анемии в пятидневном возрасте делают инъекции препаратов на основе железа — Ферродекс, Ферроглюкин.

чем лечить в домашних условиях и что давать

Понос у поросят – проблема, с которой часто сталкиваются собственники домашних животных. Стремительная потеря жидкости на фоне расстройств ЖКТ может стать причиной смертельного исхода. Поэтому при выраженной слабости, частых дефекациях, жидком кале у животного следует незамедлительно обратиться к специалисту и начать лечение. В терапевтических целях врачи рекомендуют регидрационные растворы, антибактериальные препараты и травяные отвары.

Причины

Слабый и неокрепший организм маленького выводка требует особого внимания и ухода. Существует множество причин возникновения поноса у поросенка:

  • Нарушение метаболических процессов на фоне неправильного питания, ввода новой пищи, недоедания. Диарея часто возникает при отлучке поросят от материнского молока и резкого перевода на комбикорм. Нарушения в обмене веществ возможно при недостаточном поступлении витаминов А, Д, кальция и фосфора, которые необходимы для здорового функционирования органов ЖКТ и эндокринной системы.
  • Антисанитария, повышенная влажность, неподходящий температурный режим в помещении, в котором проживает выводок, создают благоприятные условия для развития бактерий и грибков.
  • Несвоевременный и некачественный уход за поросятами.
  • Заражение. Проникновение бактериальной или вирусной флоры в организм происходит с продуктами питания (тухлыми отходами), водой, материнским молоком, а также в период внутриутробного развития от больной свиноматки.
  • Отравление поросят химическими моющими средствами, бензином, красками, удобрениями для растений и другими токсическими веществами, которые приводят к нарушению работы кишечника.
  • Различные патологии органов ЖКТ различной природы, глистные инвазии.
  • Длительное воздействие на маленький организм высоких температур окружающей среды.

Симптомы

Понос у поросят легко поддается диагностике, так как болезнь имеет выраженные симптомы. Это жидкий стул, отхождение которого происходит неконтролируемо и достаточно часто, более 5 раз в сутки. Во время диареи у поросят под хвостом влажная кожа.

Вместе с поносом происходит вымывание из организма воды и питательных компонентов, необходимых для жизнедеятельности. На этом фоне происходит стремительное ухудшение общего состояния выводка: животные становятся слабыми, вялыми, сонливыми. Аппетит снижается или полностью исчезает, в результате чего поросята могут потерять и вес при поносе.

Самостоятельная дифференциальная диагностика

Понос у маленьких поросят по густоте, запаху, окрасу и другим физиологическим характеристикам отделяемого биологического материала можно самостоятельно дифференцировать.

Водянистые каловые массы – признак серьезных нарушений в работе ЖКТ, которые нередко носят врожденный характер. Пенистый кал с запахом гнилых яблок указывает на бродильные процессы в организме, которые имеют инфекционную природу, как правило, бактериальную.

Серый и жирный стул указывает на сбои в работе желудка или поджелудочной железы. Если в результате опорожнения отделяемое имеет белый цвет — это признак печеночных патологий.

Зеленый или желтый цвет кала с кислым запахом свидетельствует о нарушении моторики кишечника. Если у поросят понос сопровождается отделением сгустков крови, кровяных прожилок или кал имеет черный цвет – это симптом внутренних кровотечений ЖКТ. Чем темнее биологический материал, тем выше находится проблема.

Понос у поросят в зависимости от их возраста

В зависимости от возраста свиней диарея имеет свои особенности и причины.

У новорожденных

В период новорожденности поросята поносят чаще всего. Это связано с несформированностью иммунитета и высокой уязвимостью к инфекционным агентам внешней среды.

Нередко заражение происходит от матери во время внутриутробного развития, когда бактерии и вирусы проникают сквозь плодную оболочку. Жидкий стул отмечается сразу после рождения. Нередко инфицирование происходит через материнское молоко.

Важную роль в период новорожденности играет и питание свиноматки, от которого зависит качество и состав молока. Поэтому важно обеспечить достаточное поступление витаминов и минералов вместе с пищей. Весь корм должен быть высокого качества с хорошим сроком годности.

У поросят первого месяца жизни диарея инфекционной природы опасна, так как существует высокий риск заражения других особей. В этот период вероятность летального исхода превышает 60%.

У сосунов

У поросят сосунов диарея связана со следующими факторами:

  • Мастит у свиноматки, который привод к изменению качественных характеристик молока. В этом случае необходимо лечение матери. У выводка проводится симптоматическая терапия.
  • Недостаток молока приводит к нехватке питательных веществ и расстройству стула.
  • Охота свиноматки. Спустя неделю в крови матери может снижаться уровень пролактина – гормона отвечающего за выработку молока. Снижение его концентрации также приводит к росту полового влечения: свиноматка становится беспокойной.
  • Повышенная жирность молока значительно разжижает стул поросят. Для нормализации состава необходимо подобрать специальный режим питания для матери.
  • Холод в помещении.

У подросших

Понос у свиней старше 2 месяцев встречается значительно реже, чем у новорожденных и сосунов, что связано с окончанием формирования органов желудочно-кишечного тракта и укреплением иммунитета. В этот период диарея связана с:

  • воздействием высоких температур на организм поросят, в результате чего нарушается моторика кишечника;
  • отравлением некачественными продуктами питания;
  • адаптацией к новым грубым кормам.

Чем лечить понос у поросят в домашних условиях?

Если поросята поносят — необходимо незамедлительно принять первые меры по предупреждению обезвоживания и вызвать ветеринара, который диагностирует причину диареи и назначит необходимую терапию.

Мнение эксперта

Дубас Андрей Леонидович

Ведущий врач  терапевт ветеринарной клиники доктора Бугаева

При первых признаках необходимо предупредить обезвоживание путем перорального введения специальных растворов:

  • Регидрон предлагается животным в объеме 200 мл/10кг массы 5 раз/сутки. Пакетик порошка разводится в 1 л теплой воды. Заменить покупной раствор можно приготовленным самостоятельно: в стакане воды растворить по 1 ч л сахара и соли.
  • Хлорид калия вводится на пустой желудок перед приемом пищи трижды в сутки с разовой дозировкой по 10 мг.
  • Раствор натрия хлорида 0,9% допустимо использовать при необходимости срочной помощи животному. Суточная дозировка для поросенка составляет 100 г.

Для терапии поноса у маленьких поросят инфекционной природы ветеринары прописывают лекарства с антибактериальным действием. Лекарства для перорального приема рекомендуют смешивать с сухим кормом или растворяют их в воде.

  • Бровасептол — порошкообразный антибиотик назначается в дозировке 1 г/10 кг веса. Продолжительность терапии от 3 до 5 суток. При сильной диарее Бровасептол вводится внутримышечно.
  • Аколан прописывается при жидком стуле в объеме 1 г на 10 кг веса особи. Кратность приема – дважды/сутки через каждые 12 часов. Длительность терапевтического курса 5 дней.
  • Броваформ – антибиотик широкого спектра действия для перорального приема. Назначается по 1 г на 20 кг веса поросенка двукратно в течение 5 дней.
  • Амоксициллин – представитель пенициллинов. Назначается в виде порошка или уколов. Дозировка исходит из выраженности клинической картины и, как правило, составляет 20 мг/кг массы в течение дня. Дневная дозировка делится на 3 приема и не должна превышать 1 г.
  • Биовит для поросят представляет собой лекарство с хлортетрациклином, протеинами, минералами и витаминами группы В, которые необходимы для нормальной работы желудка и кишечника. В первый месяц жизни назначается по 0,75 г в день. С 2 по 6 месяц жизни терапевтические дозировки увеличиваются до 3 г в сутки. После 6 месяцев препарат прописывается в объеме 7,5 г.

У вьетнамских поросят

У представителей данного вида функционирование ЖКТ несколько отличается от других пород, в связи, с чем понос у маленьких поросят лечится другими препаратами:

  • Тетрациклином или Левомицетином, которые назначаются в дозировке от 35 мг/кг массы животного;
  • Фармазин 50 мг предназначен для внутримышечного введения;
  • Фуразолидон назначается исходя из пропорций по 3 мг на каждый килограмм массы животного.

Как лечить понос у поросят в домашних условиях народными средствами?

Лечение народными средствами возможно, если понос имеет неинфекционную природу. Для регидратации возможно использование настоев ромашки, календулы, облепихи, крапивы, коры дуба. Травы можно использовать отдельно или смешивать. Для приготовления настоев необходимо залить 2 ст. л измельченных растений 500 мл воды и настоять в течение 2-3 часов под крышкой при комнатной температуре.

Настои вливаются в ротовую полость 3 раза/день перед каждым кормлением. Разовый объем исходит из пропорций: 10 мл раствора на каждый килограмм массы тела поросенка.

Для нормализации стула и восстановления моторики кишечника рекомендуется использовать рисовый, овсяный или льняной отвар. Для приготовления необходимо залить 5 ст. л измельченной крупы или семян 500-600 мл воды, довести до кипения и томить на слабом огне в течение получаса. Охладить и предлагать по половине стакана каждые 2-3 часа.

Если поросенок запоносил, для восстановления работы кишечника, восполнения дефицита витаминов и микроэлементов можно добавлять в пищу и воду по 1 ч. л спиртовой хвойной настойки, которую можно приобрести в аптеке или приготовить самостоятельно. Для этого понадобится 250-300 г измельченной хвои и 0,5 л водки. Смешать ингредиенты и настаивать в холодильнике в течение 14 дней. По окончании срока отфильтровать.

Профилактика

Для профилактики поноса у поросят важно кормить их по расписанию. Все продукты должны быть полезными и содержать достаточное количество витаминов, микро и макроэлементов. Недостаток питательных веществ можно восполнить биологически активными добавками к пище. Сбалансированным также должно быть питание и у свиноматки, молоко которой употребляют поросята в течение первых недель жизни.

В первые 5 дней жизни для предупреждения диареи и железодефицитного состояния ветеринары рекомендуют внутримышечные инъекции Ферродекс или Ферроглюкин.

Для исключения поноса у маленьких свиней во время перехода на новую пищу следует вводить новые продукты постепенно и давать рыбий жир.

В свинарнике должно быть тепло и сухо. Это поможет исключить размножение патогенной флоры и ее проникновение в организм животных. Для исключения диареи глистной природы рекомендуется использовать соответствующие медикаменты, которые назначаются курсами.

Понос у поросят опасен, так как приводит к быстрому обезвоживанию организма и может привести к гибели всего выводка. Причин диареи множество, среди которых некачественное питание, плохие условия содержания, инфекции. Для лечения назначаются антибактериальные лекарства поросятам от поноса. Для восстановления водного баланса — регидрационные растворы. В качестве вспомогательных средств допустимо использование травяных отваров и настоев.

Рейтинг автора

176

Автор статьи

Автор с опытом редактора более 10 лет. Главное в статье - принести пользу её читателю.

Написано статей

17

Загрузка...

Понос у поросят — обзор причин, как и чем лечить в домашних условиях?

Выращивание, разведение свиней, поросят очень выгодное, но в тоже время хлопотное дело. Необходимо создать оптимальные условия содержания, а также постоянно следить за поведением, состоянием здоровья своих подопечных. К примеру, диарея у поросят, взрослых животных может сигнализировать о развитии вирусных, бактериальных, паразитарных заболеваний. Чтобы не допустить гибели всего поголовья, очень важно своевременно начать адекватное лечение. Рассмотрим причины диареи у свиней, а также что делать, если поросят запоносили. Чем можно вылечить в домашних условиях животных? Как лечить диарею у сосунов?

Причины расстройства желудка

Диарея у поросят — очень тревожный симптом, который может не только привести к истощению животных, но и стать причиной гибели поголовья. Характеризуется частым опорожнением кишечника. Каловые массы имеют жидкую консистенцию, могут содержать слизь, пену, кровянистые сгустки, вкрапления.

Понос может быть у новорожденных, подросших особей, у взрослых свиней.

рекомендуемые статьи:
  • Что делать и чем лечить, если у кроликов понос?
  • Как лечить понос у козлят и взрослых коз?

Важно! Если диарея появилась у поросят, которые постоянно питаются молоком свиноматки, нужно сразу назначить лечение. Как правило, больных сосунов в помете несколько.

Диарея у поросят — тревожный симптом, который может спровоцировать сильное истощение, обезвоживание организма

Основной причиной расстройства желудка у поросят, взрослых животных можно назвать погрешности в питании, несбалансированный, некачественный рацион. Диарея у поросят может возникнуть также при резкой смене режима, типа питания, кормления протухшими, некачественными комбикормами.

Если поросята поносят, среди возможных причин можно выделить:

  • отсутствие должной гигиены в помещениях, в которых содержатся животные;
  • отравление ядовитыми веществами, семенами растений;
  • глистные инвазии;
  • заразные, незаразные болезни;
  • переохлаждение организма, недостаточный температурный режим в свинарниках;
  • гипо-, авитаминоз;
  • врожденные, приобретенные патологии органов ЖКТ;
  • нарушение метаболизма.
Гельминты часто становятся причиной расстройства желудка у поросят, взрослых свиней

Диарея у поросят часто указывает на то, что они заражены какой-либо инфекцией, вирусным, бактериальным, паразитарным заболеванием. Понос у свиней также может возникнуть из-за переедания, поедания ядовитых растений.

Диарея у новорожденных поросят

При поносе у поросят-сосунов отмечают частое интенсивное выделение водянистых каловых масс. Поскольку диарея у новорожденных малышей — явление относительно нечастое, причина подобного состояния кроется в кормящей свиноматке. Возможно, она инфицирована вирусами, бактериями, внутренними паразитами, которые провоцируют кишечные инфекции, особенно в том случае, если она часто отлучается от своего выводка.

Диарея у сосунков чаще всего спровоцирована несбалансированным питанием свиноматки

Если поросята запоносили, это может быть спровоцировано также тем, что рацион кормящей свиноматки состоит из большого количества грубых, твердых кормов. Некоторые виды трав, растений, которые поедает свинья, также могут привести к расстройству желудка у малышей. Большое количество молока часто вызывает диарею у сосунов.

Диарея у подросших поросят

У подросших поросят в возрасте 2–3 месяцев диарея — довольно частое явление. Расстройство желудка может быть спровоцировано самыми различными факторами. В возрасте нескольких месяцев малыши ведут подвижный, активный образ жизни. Если поросят выпускают на выгул, они могут подхватить кишечную инфекцию, заболевания от других домашних животных, птиц, грызунов.

Очень часто причиной диареи у поросят являются вирусно-бактериальные болезни, которые представляют опасность не только для здоровья, но и для жизни животных. Заражение может произойти контактным, алиментарным, эрогенным путем. Подцепить инфекцию свинки могут от скрытых вирусоносителей. Если на фоне диарее заметна другая побочная симптоматика, необходимо срочно предпринять соответствующие меры, начать лечение.

При диарее поросята становятся вялыми, малоподвижными, быстро теряют в весе

Если понос у маленьких поросят не является симптомом инфекций, заболеваний, расстройство желудка могут спровоцировать жаркие погодные условия. Сильный перегрев, как и переохлаждение, очень негативно сказывается на работе органов пищеварительного тракта.

У подросших поросят понос может быть вызван перееданием. Маленькие свинки ведут подвижный образ жизни и если сильно проголодаются, начинают жадно поедать пищу. Плохо измельченные, грубые корма провоцируют расстройство желудка у этих животных на несколько дней. Чем лечить в домашних условиях понос у поросят, подскажет ветврач, поскольку терапия, дальнейшие действия зависят от первопричин, которые спровоцировали подобное состояние.

Симптомы диареи

Если поросята поносят, основной признак — частый, жидкий стул водянистой, кашицеобразной жидкой консистенции. В каловых массах, которые могут литься неконтролируемо, часто присутствует слизь, пена, кровянистые нити, сгустки, вкрапления, остатки непереваренного корма.

Основная опасность при расстройстве желудка у поросят заключается в функциональных нарушениях в работе ЖКТ, других органов и систем, а также в быстром обезвоживании организма. На фоне диареи может развиться другая побочная симптоматика, физиологические нарушения, изменения в метаболизме.

Важно! Определить причину диареи можно по цвету, консистенции, общему виду каловых масс.

Белый стул указывает на поражение печени. Пенистая диарея — частый симптом глистных инвазий, вирусных заболеваний. Черный, кровавый, бурый понос сигнализирует о возможных кровотечениях в органах ЖКТ. Специфически резкий гнилостный запах, исходящий от каловых масс, — симптом брожения в кишечнике.

Поросята теряют вес, нет прироста живой массы. Животные слабеют, становятся малоактивными, ложатся на бок. Отмечают снижение либо полное отсутствие аппетита. Возможна рвота, тошнота, повышенная жажда.

Если помимо диареи у поросят заметны другие клинические симптомы, нужно незамедлительно связаться с ветврачом. Специалист после диагностики подберет эффективное лечение. Чем и как лечить понос у поросят в домашних условиях? Что нужно дать поросенку для нормализации работы ЖКТ? 

Лечение

При поносе у поросенка нужно определить причину подобного состояния. Чтобы не спровоцировать серьезных физиологических нарушений, лечение диареи должно быть комплексным. Чаще всего животным назначают медикаментозное лечение. При этом запущенную стадию лечить гораздо труднее. При поносе у поросят лечение нужно проводить в первый день, особенно, если есть подозрение на инфекцию.

Важно! Чем лечить в домашних условиях понос у поросят, какие использовать медикаментозные средства, подскажет врач ветеринарной медицины. Сделайте все, что порекомендует специалист, соблюдайте дозировки препарата, придерживайтесь установленной врачом схемы лечения. Если у поросят сильная диарея, лечение может занять несколько суток.

Если понос не спровоцирован инфекцией, пересмотрите рацион питомцев, обеспечьте оптимальные условия содержания, проведите дезинфекцию в помещениях, где содержатся животные.

Если диарея у поросят-сосунов вызвана несбалансированным рационом матери, давайте свиноматке меньше твердых, грубых кормов. Следите за тем, чтобы лактирующая свинка не контактировала с другими домашними животными.

Поросятам дают лекарство, медикаментозные средства, действие которых направлено на снижение моторики кишечника, улучшение, нормализацию пищеварительных процессов. При поносе у поросят лечение совмещают с другими профилактическими мерами.

Бровафом — эффективное средство при диарее у поросят

Лечение будет эффективным при соблюдении оптимального баланса микроэлементов и солей в организме животных. Поросятам дают хлористый калий (10%) 3 раза в день по 10 мг. Его можно заменить 1%-ным раствором поваренной соли в расчете 5 г на 500 мл воды.

Поросятам-сосунам можно давать обволакивающие растворы, пробиотики, ферментные средства. Можно дать 0,9%-ный раствор натрия хлорида, который поможет устранить признаки обезвоживания. В дополнение к основному лечению проводят ферментотерапию. Это даст хороший эффект при нарушении процессов пищеварения.

Опытные фермеры дают подкисленную лимоном воду (1 мл на литр воды), Регидрон, другие адсорбенты.

Важно! Давать лекарственные средства лучше всего поросятам натощак.

Если это не дало положительных результатов, при диарее, вызванной инфекциями, вирусными заболеваниями животным назначают антибиотики, сульфаниламиды.

Из медикаментов при диарее поросятам назначают:

  1. Бровасептол. Выпускается в виде порошка, который подмешивают и дают вместе с пищей из расчета 3–4 г на кг корма. Лечение занимает пять суток.
  2. Бровафом. Представляет собой хорошо растворимый в воде порошок. Можно добавлять в комбикорма (1 кг лекарства на 500 кг комбикорма).
  3. Биовит. Ветпрепарат содержит необходимый для нормального пищеварения витамин В12, антибиотик гидрохлорид тетрациклина. Нужно давать лекарство поросенку раз в сутки. Продолжительность лечения — 6–7 дней. Если возраст поросят до 10 суток, то расчет проводят, исходя из 15 г препарата на 10 кг веса. Если малышам от 1 до 2 месяцев, то дают по 6 г на 1 кг веса, а 4-месячным нужно давать по 15 грамм препарата.
Лекарства добавляют в корма питьевую воду

Средства нетрадиционной медицины

Вылечить диарею у маленьких поросят можно народными средствами. При этом не забудьте проконсультироваться с ветврачом, чтобы избежать возможных осложнений. Расстройство желудка поможет устранить рисовая болтушка, водно-спиртовая настойка хвои, отвар ромашки, зверобоя, коры дуба, череды. Дайте больной свинке корень цикория (50 г на литр воды), настойку крапивы двудомной в пропорции 1/1, крепкий настой из правильно высушенного сена. Целебные растения используют из расчета 40 г на литр воды. Добавляют в поилки, заменив обычную питьевую воду.

От поноса поросятам очень хорошо помогает рисовая болтушка. Чтобы ее приготовить, возьмите 1 кг риса, проварите крупу в 10 литрах воды. Слейте лишнюю воду. Давайте поросятам по 100 г болтушки четыре раза в сутки.

Рисовая болтушка быстро устранит расстройство желудка

Если у поросенка сильный понос, в аптеках можно приобрести хвойную вытяжку. Опытный фермер дает больному животному по 2 мл трижды в сутки. Заливают в глотку поросенку при помощи шприца без иглы или большой ложкой. Если этого мало, можно увеличить дозу до 3 мл, но только подросшим поросятам, взрослым свинкам. Данная настойка поможет быстро устранить расстройство желудка. 

Рассмотрев, как лечить диарею у маленьких поросят, можно быстро нормализовать состояние больных животных. Главное — правильно определить причину подобного состояния и как можно быстрее начать соответствующее комплексное лечение.

Похожие статьи:

Какие таблетки можно дать поросятам от поноса

Диарея у свиней — тревожный симптом, который нельзя игнорировать. В тяжелых случаях это может привести к гибели всего стада.

Поэтому каждый фермер должен знать проявления и возможные причины расстройства пищеварения, а также способы лечения. Особенно опасно, если понос у поросят первых недель жизни.

Чем опасна диарея у поросят и свиней?

Лечить понос у поросенка нужно обязательно, это не та проблема, которая бесследно уйдет сама. Диарея – опасное состояние, способное, в некоторых случаях, привести к падежу не только молодняка, но и всего поголовья взрослых свиней.

Важно! Понос – это не болезнь, а только симптом какого-то отклонения в работе организма. Перед тем, как лечить у поросенка расстройство желудка, нужно выяснить его причину.

Диарея очень коварна, ведь всего за несколько часов она может привести к гибели маленького поросенка. Состояние это тем опаснее, чем меньше масса животного: малыши погибают очень быстро. На спасение взрослой и сильной свиньи от поноса у фермера, как правило, есть несколько суток.

Сильный понос, усугубленный рвотой и высокой температурой, приводит к быстрому выведению жидкости из организма. Вместе с водой тело поросенка покидают ценные соли и минеральные вещества, без которых невозможна работа жизненно важных органов (сердца, нервной системы, мозга).

Именно обезвоживание, в паре с интоксикацией, становится причиной массового падежа свиней. Лечение поноса на первых этапах должно быть направлено на восстановление солевого и щелочного баланса в организме поросенка.

Почему поносят?

Диарея у поросят характеризуется частым опорожнением кишечника. Каловые массы имеют жидкую консистенцию, могут содержать слизь, пену, кровянистые сгустки, вкрапления.

Понос может быть у новорожденных, подросших особей, у взрослых свиней.

Важно! Если диарея появилась у поросят, которые постоянно питаются молоком свиноматки, нужно сразу назначить лечение. Как правило, больных сосунов в помете несколько.

Основной причиной расстройства желудка у поросят, взрослых животных можно назвать погрешности в питании, несбалансированный, некачественный рацион.

Диарея у поросят может возникнуть также при резкой смене режима, типа питания, кормления протухшими, некачественными комбикормами.

Если поросята поносят, среди возможных причин можно выделить:

  • отсутствие должной гигиены в помещениях, в которых содержатся животные;
  • отравление ядовитыми веществами, семенами растений;
  • глистные инвазии;
  • заразные, незаразные болезни;
  • переохлаждение организма, недостаточный температурный режим в свинарниках;
  • гипо-, авитаминоз;
  • врожденные, приобретенные патологии органов ЖКТ;
  • нарушение метаболизма.

Диарея у поросят часто указывает на то, что они заражены какой-либо инфекцией, вирусным, бактериальным, паразитарным заболеванием. Понос у свиней также может возникнуть из-за переедания, поедания ядовитых растений.

Новорожденные

При поносе у поросят-сосунов отмечают частое интенсивное выделение водянистых каловых масс. Поскольку диарея у новорожденных малышей — явление относительно нечастое, причина подобного состояния кроется в кормящей свиноматке.

Возможно, она инфицирована вирусами, бактериями, внутренними паразитами, которые провоцируют кишечные инфекции, особенно в том случае, если она часто отлучается от своего выводка.

Если поросята запоносили, это может быть спровоцировано также тем, что рацион кормящей свиноматки состоит из большого количества грубых, твердых кормов.

Некоторые виды трав, растений, которые поедает свинья, также могут привести к расстройству желудка у малышей. Большое количество молока часто вызывает диарею у сосунов.

У сосунов

У поросят сосунов диарея связана со следующими факторами:

  • Мастит у свиноматки, который привод к изменению качественных характеристик молока. В этом случае необходимо лечение матери. У выводка проводится симптоматическая терапия.
  • Недостаток молока приводит к нехватке питательных веществ и расстройству стула.
  • Охота свиноматки. Спустя неделю в крови матери может снижаться уровень пролактина – гормона отвечающего за выработку молока. Снижение его концентрации также приводит к росту полового влечения: свиноматка становится беспокойной.
  • Повышенная жирность молока значительно разжижает стул поросят. Для нормализации состава необходимо подобрать специальный режим питания для матери.
  • Холод в помещении.

Подросшие

У подросших поросят в возрасте 2–3 месяцев диарея — довольно частое явление. Расстройство желудка может быть спровоцировано самыми различными факторами.

В возрасте нескольких месяцев малыши ведут подвижный, активный образ жизни. Если поросят выпускают на выгул, они могут подхватить кишечную инфекцию, заболевания от других домашних животных, птиц, грызунов.

Очень часто причиной диареи у поросят являются вирусно-бактериальные болезни, которые представляют опасность не только для здоровья, но и для жизни животных. Заражение может произойти контактным, алиментарным, эрогенным путем.

Подцепить инфекцию свинки могут от скрытых вирусоносителей. Если на фоне диарее заметна другая побочная симптоматика, необходимо срочно предпринять соответствующие меры, начать лечение.

Если понос у маленьких поросят не является симптомом инфекций, заболеваний, расстройство желудка могут спровоцировать жаркие погодные условия. Сильный перегрев, как и переохлаждение, очень негативно сказывается на работе органов пищеварительного тракта.

У подросших поросят понос может быть вызван перееданием. Маленькие свинки ведут подвижный образ жизни и если сильно проголодаются, начинают жадно поедать пищу.

Плохо измельченные, грубые корма провоцируют расстройство желудка у этих животных на несколько дней. Чем лечить в домашних условиях понос у поросят, подскажет ветврач, поскольку терапия, дальнейшие действия зависят от первопричин, которые спровоцировали подобное состояние.

Симптомы диареи

ПризнакиБолезнь
Водянистая консистенция калаНарушения в работе кишечного тракта
Пенистые испражнения с запахом гнили, сухость кожных покровов, повышенная температураЗаражение болезнетворными бактериями
Жирные, серые фекалииНарушения в работе ЖКТ
Желтоватый или зеленоватый кал, кислый, тухлый запахПища плохо усваивается в тонком кишечнике
Испражнения светлее обычногоОрганизм вырабатывает мало желчи
Снижение аппетита, выделения из ушных раковин и глаз, сухость кожи, рвота, высокая температура, иногда — кровь в моче, чрезмерное возбуждение или угнетение, судороги, одышка, параличОтравление
То же, плюс кашель, хрипы, потеря веса, почесывания, самоизоляция от остального стада, иногда — повышение агрессииГлистная инвазия
Черный цвет фекалийКровотечение в органах ЖКТ

Если поросята поносят, основной признак — частый, жидкий стул водянистой, кашицеобразной жидкой консистенции.

В каловых массах, которые могут литься неконтролируемо, часто присутствует слизь, пена, кровянистые нити, сгустки, вкрапления, остатки непереваренного корма.

Основная опасность при расстройстве желудка у поросят заключается в функциональных нарушениях в работе ЖКТ, других органов и систем, а также в быстром обезвоживании организма.

На фоне диареи может развиться другая побочная симптоматика, физиологические нарушения, изменения в метаболизме.

Важно! Определить причину диареи можно по цвету, консистенции, общему виду каловых масс.

Белый стул указывает на поражение печени. Пенистая диарея — частый симптом глистных инвазий, вирусных заболеваний. Черный, кровавый, бурый понос сигнализирует о возможных кровотечениях в органах ЖКТ.

Специфически резкий гнилостный запах, исходящий от каловых масс, — симптом брожения в кишечнике.

Поросята теряют вес, нет прироста живой массы. Животные слабеют, становятся малоактивными, ложатся на бок. Отмечают снижение либо полное отсутствие аппетита. Возможна рвота, тошнота, повышенная жажда.

Если помимо диареи у поросят заметны другие клинические симптомы, нужно незамедлительно связаться с ветврачом. Специалист после диагностики подберет эффективное лечение.

Лечение в домашних условиях

При поносе у поросенка нужно определить причину подобного состояния. Чтобы не спровоцировать серьезных физиологических нарушений, лечение диареи должно быть комплексным.

Чаще всего животным назначают медикаментозное лечение. При этом запущенную стадию лечить гораздо труднее. При поносе у поросят лечение нужно проводить в первый день, особенно, если есть подозрение на инфекцию.

Если понос не спровоцирован инфекцией, пересмотрите рацион питомцев, обеспечьте оптимальные условия содержания, проведите дезинфекцию в помещениях, где содержатся животные.

Если диарея у поросят-сосунов вызвана несбалансированным рационом матери, давайте свиноматке меньше твердых, грубых кормов. Следите за тем, чтобы лактирующая свинка не контактировала с другими домашними животными.

Поросятам дают лекарство, медикаментозные средства, действие которых направлено на снижение моторики кишечника, улучшение, нормализацию пищеварительных процессов. При поносе у поросят лечение совмещают с другими профилактическими мерами.

Лечение будет эффективным при соблюдении оптимального баланса микроэлементов и солей в организме животных. Поросятам дают хлористый калий (10%) 3 раза в день по 10 мг. Его можно заменить 1%-ным раствором поваренной соли в расчете 5 г на 500 мл воды.

Поросятам-сосунам можно давать обволакивающие растворы, пробиотики, ферментные средства. Можно дать 0,9%-ный раствор натрия хлорида, который поможет устранить признаки обезвоживания.

В дополнение к основному лечению проводят ферментотерапию. Это даст хороший эффект при нарушении процессов пищеварения.

Опытные фермеры дают подкисленную лимоном воду (1 мл на литр воды), Регидрон, другие адсорбенты.

Важно! Давать лекарственные средства лучше всего поросятам натощак.

Если это не дало положительных результатов, при диарее, вызванной инфекциями, вирусными заболеваниями животным назначают антибиотики, сульфаниламиды.

Из медикаментов при диарее поросятам назначают:

  • Бровасептол. Выпускается в виде порошка, который подмешивают и дают вместе с пищей из расчета 3–4 г на кг корма. Лечение занимает пять суток.
  • Бровафом. Представляет собой хорошо растворимый в воде порошок. Можно добавлять в комбикорма (1 кг лекарства на 500 кг комбикорма).
  • Биовит. Ветпрепарат содержит необходимый для нормального пищеварения витамин В12, антибиотик гидрохлорид тетрациклина. Нужно давать лекарство поросенку раз в сутки. Продолжительность лечения — 6–7 дней. Если возраст поросят до 10 суток, то расчет проводят, исходя из 15 г препарата на 10 кг веса. Если малышам от 1 до 2 месяцев, то дают по 6 г на 1 кг веса, а 4-месячным нужно давать по 15 грамм препарата.
  • Аколан. Это монопрепарат на основе антибиотика колистина. Показан при инфекционных болезнях ЖКТ. Средство выпускается в виде порошка для разведения в воде. Раствор дают поросятам с водой или молоком в дозе 1 г/кг веса дважды в сутки. Терапию продолжают 3 суток. Активное вещество выводится за 24 часа.

В случае подозрения глистных инвазий используют такие лекарственные средства: Альбен; Ивермек; Нилверм. Одни средства обладают широким спектром действия, другие эффективны против отдельных видов паразитов.

Поэтому назначать препарат должен только ветврач после установления типа глистов.

Народные средства

Вылечить диарею у маленьких поросят можно народными средствами. При этом не забудьте проконсультироваться с ветврачом, чтобы избежать возможных осложнений.

Расстройство желудка поможет устранить рисовая болтушка, водно-спиртовая настойка хвои, отвар ромашки, зверобоя, коры дуба, череды.

Дайте больной свинке корень цикория (50 г на литр воды), настойку крапивы двудомной в пропорции 1/1, крепкий настой из правильно высушенного сена.

Целебные растения используют из расчета 40 г на литр воды. Добавляют в поилки, заменив обычную питьевую воду.

От поноса поросятам очень хорошо помогает рисовая болтушка. Чтобы ее приготовить, возьмите 1 кг риса, проварите крупу в 10 литрах воды. Слейте лишнюю воду. Давайте поросятам по 100 г болтушки четыре раза в сутки.

Если у поросенка сильный понос, в аптеках можно приобрести хвойную вытяжку. Опытный фермер дает больному животному по 2 мл трижды в сутки.

Заливают в глотку поросенку при помощи шприца без иглы или большой ложкой. Если этого мало, можно увеличить дозу до 3 мл, но только подросшим поросятам, взрослым свинкам. Данная настойка поможет быстро устранить расстройство желудка.

Пошаговая инструкция по приготовлению домашнего аналога Регидрона:

  • Кипятят 1 литр воды;
  • Дают воде остыть до 40-50 °С;
  • Всыпают 1 столовую ложку сахара;
  • Всыпают 1 столовую ложку соли;
  • Перемешивают, пока кристаллы полностью не растворятся;

Также, одним из способов борьбы с поносом есть взболтанные куриные сырые яйца, так называемый гоголь-моголь, который может дать положительный эффект, но только на начальном этапе.

Терапия при подозрении на отравление

При отравлении выясняют, какое именно вещество стало причиной недомогания. ЖКТ промывают, дают противоядие — например, Унитол. Этот препарат эффективен против мышьяка, висмута, других тяжелых металлов. Исключение составляет свинец.

Применяют адсобренты, мочегонные, общеукрепляющие средства. При отравлении солью показаны внутримышечные инъекции глюконата кальция.

Интоксикацию нитритами и нитратами лечат раствором метиленового синего с глюкозой, препарат вводят внутривенно.

Вьетнамские поросята

У вьетнамских поросят У представителей данного вида функционирование ЖКТ несколько отличается от других пород, в связи, с чем понос у маленьких поросят лечится другими препаратами:

  • Тетрациклином или Левомицетином, которые назначаются в дозировке от 35 мг/кг массы животного;
  • Фармазин 50 мг предназначен для внутримышечного введения;
  • Фуразолидон назначается исходя из пропорций по 3 мг на каждый килограмм массы животного.

Рассмотрев, как лечить диарею у маленьких поросят, можно быстро нормализовать состояние больных животных. Главное — правильно определить причину подобного состояния и как можно быстрее начать соответствующее комплексное лечение.

Меры профилактики

Особое внимание уделяют питанию самых младших членов поголовья. Новые продукты вводят в рацион осторожно. Затем ждут несколько дней, наблюдая за реакцией организма. Кормления проводят в одни и те же часы.

Чтобы у маленьких поросят не возник кровавый понос, пищу измельчают и перемешивают. Особенно это касается вьетнамский свиней, желудочно-кишечная система которых не способна переваривать слишком грубую пищу.

Если в рационе уже присутствует трава, то нельзя давать ее сразу после покоса. Сначала зелень немного привяливают, и только после этого кладут в кормушки. В таком виде продукт лучше переваривается и не приводит к расстройствам пищеварения.

На подворье, где выгуливаются свиньи, не должно быть ядовитых трав. К ним относятся:

  • вех ядовитый;
  • дурман;
  • чемерица;
  • лютик;
  • паслен;
  • горчица.

Корма всегда должны быть свежими, без признаков гниения и плесени. Нельзя оставлять влажные мешанки дольше, чем на 2–3 часа. Перед каждым приемом пищи емкости для корма очищают от остатков пищи и загрязнений.

3 раза в месяц кормушки и поилки обдают кипятком. Сразу после появления на свет поросят выпаивают теплой прокипяченной водой. В нее добавляют марганцовку, чтобы получился бледно-розовый раствор.

Не менее полезны отвары злаков — овса, риса, а также семян льна. В свинарнике регулярно убирают. Влага, грязь, холод способствуют распространению инфекционных заболеваний.

Каждый год стены белят известью. Дважды в неделю загоны подлежат дезинфекции. Подстилку меняют ежедневно. Периодически поросятам дают витаминные комплексы и рыбий жир.

Для предупреждения диареи и анемии в пятидневном возрасте делают инъекции препаратов на основе железа — Ферродекс, Ферроглюкин.

причины и основные методы лечения

Диарея у свиней — тревожный симптом, который нельзя игнорировать. В тяжелых случаях это может привести к гибели всего стада. Поэтому каждый фермер должен знать проявления и возможные причины расстройства пищеварения, а также способы лечения. Особенно опасно, если понос у поросят первых недель жизни.

Понос у поросят — тревожный симптом, который опасно оставлять без внимания

О том, что едят свиньи, можете прочитать в нашей статье — здесь.

Содержание статьи

Что такое понос и какие у него проявления

Диарея переводится с греческого как «протекание». В норме кал у поросят и взрослых свиней средней густоты. При поносе испражнения становятся жидкими. В норме дефекация у этих животных происходит 4–5 раз в сутки. Если этот показатель выше, то можно говорить о поносе.

Основные признаки диареи:

  • жидкие каловые массы вытекают из заднего прохода произвольно;
  • влажность под хвостом;
  • вялость, снижение аппетита;
  • обычно активное животное предпочитает лежать на боку.

Заболевший поросенок становится вялым

Почему поросята поносят

У свиней любого возраста диарея возникает по таким причинам:

  • несоблюдение норм гигиены в помещениях для содержания животных;
  • интоксикация, вызванная ядовитыми продуктами, травами, семенами растений;
  • паразитарная инфекция;
  • различные заболевания, в том числе желудочно-кишечного тракта, причем как заразные, так и незаразные;
  • авитаминозные и гиповитаминозные состояния;
  • переохлаждение, сквозняки в свинарниках.

Диарея имеет и типичные возрастные причины, обусловленные особенностями развития организма.

От чего поносят новорожденные поросята

Первые 14 суток жизни следует особенно внимательно наблюдать за состоянием приплода. Это самый опасный период, когда падеж стада довольно высок. Если неокрепший организм поразила инфекция, молодое поголовье может погибнуть всего за полдня. Некоторые заболевания распространяются столь стремительно, что ветеринары даже не успевают провести диагностику и назначить лечение.

Инфекция может передаться с материнским молоком

Сосуны часто получают инфекцию от лактирующей самки. Это происходит незаметно для фермера, если свиноматка заразилась недавно, болезнь пока не дала о себе знать, иммунитет не сформировался. Тогда вирусы и микроорганизмы передаются потомству с инфицированным молоком.

Факторы, которые создают условия для повышения заболеваемости:

  • неблагоприятный микроклимат в помещении — слишком низкие температуры и сквозняки;
  • свиноматку перекармливают, и тогда сосунки получают больше молока, чем требует организм;

Особенно часто сбои в функционировании кишечника наблюдаются, когда меняют вид корма. Опасна слишком грубая пища, свежая трава. Такие продукты надо вводить в рацион постепенно.

Почему возникает диарея у подросших поросят

Проблемы с пищеварением — не редкость и у поросят постарше. Это связано с тем, что они много едят и часто перегружают желудок. Виной возникновения расстройства может быть и скармливание им свежескошенной травы.

Некоторые заболевания передаются от грызунов

Молодняк на выгуле получает инфекцию от сородичей или грызунов, диких птиц. Они иногда употребляют ядовитые травы, растущие на подворье. Летом расстройства в работе кишечника наблюдаются в сильную жару.

Цены на отраву для грызунов

Отрава для грызунов

Видео — Понос у поросят из-за некачественного корма

Дополнительные симптомы, указывающие на причину диареи

Диарея часто сопровождается другими клиническими признаками, которые могут указать на причину, вызвавшую недомогание.

С высокой точностью причину поноса определяют по внешнему виду фекалий

Таблица №1. Симптомы и заболевания, при которых развивается понос у поросят.

ПризнакиБолезнь
Водянистая консистенция калаНарушения в работе кишечного тракта
Пенистые испражнения с запахом гнили, сухость кожных покровов, повышенная температураЗаражение болезнетворными бактериями
Жирные, серые фекалииНарушения в работе ЖКТ
Желтоватый или зеленоватый кал, кислый, тухлый запахПища плохо усваивается в тонком кишечнике
Испражнения светлее обычногоОрганизм вырабатывает мало желчи
Снижение аппетита, выделения из ушных раковин и глаз, сухость кожи, рвота, высокая температура, иногда — кровь в моче, чрезмерное возбуждение или угнетение, судороги, одышка, параличОтравление
То же, плюс кашель, хрипы, потеря веса, почесывания, самоизоляция от остального стада, иногда — повышение агрессииГлистная инвазия
Черный цвет фекалийКровотечение в органах ЖКТ

Внимание! Иногда жидкий стул появляется при нормальной частоте испражнений. Это значит, что болезнь находится в начальной стадии. Если своевременно провести диагностику и начать лечение, то шансы на выздоровление увеличиваются.

Глистные инвазии среди причин неправильной работы кишечника

Основные методы лечения поноса у поросят

При подозрении на инфекцию нездоровых особей отделяют от здорового стада, и сообщают о факте болезни в ветеринарные службы.

Лечение поросят начинают с того, что пропускают одно или два кормления.

Если причиной стали неблагоприятные условия содержания, устраняют эти недостатки. При низких температурах воздуха устанавливают дополнительный обогрев, для чего устанавливают инфракрасные лампы. Такие осветительные приборы используют на крупных фермах.

Инфракрасные лампы хорошо прогревают помещение

Цены на инфракрасные лампы

Лампа инфракрасная

Воздушные теплогенераторы и тепловые пушки тоже могут согреть воздух в свинарнике, но у них есть недостатки. Первые вызывают движение воздушных масс, что может стать причиной сквозняка, а вторые сжигают кислород.

Надо также устранить источники сквозняков. Они, например, возникают из-за неправильного расположения оконных и дверных проемов, ошибок в проектировании системы вентиляции.

Лечение поноса у новорожденных поросят

Средства против поноса у поросят из народной медицины

Помогают избавиться от поноса и народные средства. Прежде всего, это настои лекарственных растений. Стабилизируют состояние:

  • кора дуба;
  • пижма;
  • черный чай;
  • ноготки;
  • ромашка лекарственная;
  • крапива двудомная.

20 г сухого растения заливают 500 мл горячей воды, дают настояться 40 минут.

Справка. Кора дуба — одно из наиболее эффективных средств против диареи. В ней содержится до 20% дубильных веществ. Настои на ее основе не только останавливают понос, но и снимают воспаление.

Кора дуба — одно из самых действенных народных лекарств при поносе

Травяные настои дают теплыми, трижды в сутки за полчаса до кормления. Одноразовая доза на одну голову — 10 мл (профилактическая — 5 мл).

Иногда народных методов бывает достаточно, чтобы остановить понос, вызванный погрешностями в диете. Но если эти средства не помогли, необходимо обратиться за ветеринарной помощью.

Коррекция рациона у кормящей свиноматки

Если свиноматка, в чьем помете начался понос, получает слишком много кормов, ее рацион сокращают до нормального.

Свиноматка не должна переедать

Так, самке с 10 поросятами на подсосе калорийность корма составляет около 64 МДж. При этом она должна получать:

  • сырого протеина — 800 г;
  • лизина — 40 г;
  • сырой клетчатки — 200–300 г;
  • кальция — 42,5 г;
  • фосфора — 30 г;
  • натрия — 10 г.

Таблица №2. Два примерных рациона питания для свиноматок

Название продуктаВариант 1Вариант 2
Пшеница40%35%
Ячмень40%35%
Растительное масло5%
Соевый шрот12%13%
Рыбная мука5%5%
Минеральный корм3%3%
Кальций20,5%20%
Фосфор6,5%7%
Натрий5,5%5,5%

Цены на премикс для свиней

Премикс для свиней

Медикаменты, которые используют для поросят и свиней при поносе

В ветеринарных аптеках есть достаточно препаратов, которые помогут остановить диарею и устранить ее причину. В ветеринарной медицине используют такие средства:

  • Бровасептол. Это комплексный препарат, в состав которого входят три активных компонента — сульфагуанидин, окситетрациклин, триметоприм. Средство применяется при дизентерии, сальмонеллезе, пастереллезе, отечной болезни. Скармливают его в основном групповым методом. На 100 кг комбикорма используют 350 г порошка. Забивают животных на мясо не раньше, чем на 8 сутки после окончания лечения;
  • Бровафом. Тоже содержит три действующих вещества — колистина сульфат, окситетрациклин, триметоприм. Представляет собой порошок, растворяемый в воде. Применяет при пастереллезе, заражении сальмонеллой, дизентерии, колибактериозе, неинфекционных болезнях пищеварительного тракта. Препарат дают как раствор для питья (1 кг/1000 л воды) или с комбикормом (2 кг/т). Лечение продолжают от 3 до 5 суток. Отправлять свиней на забой для получения мясной продукции разрешается не раньше, чем на десятые сутки после начала лечения;
  • Биовит. Это кормовая добавка на основе витаминов, ферментов и антибактериальных веществ (хлортетрациклина). Препарат не только борется с инфекциями, но и способствует укреплению организма поросят. Применяется средство при колибактериозе, листериозе, паратифе, сальмонеллезе, дизентерии. Дозировка зависит от количества хлортетрациклина в составе и возраста животного. Убой свиньи разрешен только на седьмые сутки после окончания лечения;
  • Аколан. Это монопрепарат на основе антибиотика колистина. Показан при инфекционных болезнях ЖКТ. Средство выпускается в виде порошка для разведения в воде. Раствор дают поросятам с водой или молоком в дозе 1 г/кг веса дважды в сутки. Терапию продолжают 3 суток. Активное вещество выводится за 24 часа.

Антибактериальные препараты, применяемые при инфекционном поносе

Внимание! Нельзя превышать дозы, указанные в инструкции. Перед применением препарата желательно проконсультироваться с ветеринарным врачом. Некоторые болезни могут быть опасны и для человека.

В случае подозрения глистных инвазий используют такие лекарственные средства:

  • Альбен;
  • Ивермек;
  • Нилверм.

Одни средства обладают широким спектром действия, другие эффективны против отдельных видов паразитов. Поэтому назначать препарат должен только ветврач после установления типа глистов.

Часто владельцы свиней используют народные средства для лечения своих подопечных. Это делать не стоит, поскольку таблетки действуют быстро и более результативно. Проволочки же могут привести к распространению инвазии среди и последующей его гибели. Однако лекарственные травы — хорошее вспомогательное средство.

Раствор Рингера — Локка восстановит солевой баланс

При обезвоживании организма поросятам дают Регидрон, который поможет восстановить электролитный баланс. На 1 кг веса показано 10 мг препарата, который растворяют в воде в соответствии с инструкцией. В ветеринарии также используется раствор Рингера — Локка. Если препарата нет под рукой, готовят его самостоятельно.

Пошаговая инструкция по приготовлению домашнего аналога Регидрона

Шаг 1.

Кипятят 1 л воды.

Вскипятите воду

Шаг 2.

Дают воде остыть до 40–50 °С.

Вода должны остыть

Шаг 3.

Всыпают 1 столовую ложку сахара.

Добавьте сахар

Шаг 4.

Всыпают 1 столовую ложку соли.

Добавьте соль

Шаг 5.

Перемешивают, пока кристаллы полностью не растворятся.

Тщательно перемешайте

Терапия при подозрении на отравление

При отравлении выясняют, какое именно вещество стало причиной недомогания. ЖКТ промывают, дают противоядие — например, Унитол. Этот препарат эффективен против мышьяка, висмута, других тяжелых металлов. Исключение составляет свинец. Применяют адсобренты, мочегонные, общеукрепляющие средства. При отравлении солью показаны внутримышечные инъекции глюконата кальция. Интоксикацию нитритами и нитратами лечат раствором метиленового синего с глюкозой, препарат вводят внутривенно.

При отравлении вводят правильный антидот

Видео — Терапия при поносе у поросят

Профилактика диареи у поросят

Особое внимание уделяют питанию самых младших членов поголовья. Новые продукты вводят в рацион осторожно. Затем ждут несколько дней, наблюдая за реакцией организма. Кормления проводят в одни и те же часы.

Чтобы у маленьких поросят не возник кровавый понос, пищу измельчают и перемешивают. Особенно это касается вьетнамский свиней, желудочно-кишечная система которых не способна переваривать слишком грубую пищу.

Если в рационе уже присутствует трава, то нельзя давать ее сразу после покоса. Сначала зелень немного привяливают, и только после этого кладут в кормушки. В таком виде продукт лучше переваривается и не приводит к расстройствам пищеварения.

ЖКТ Вьетнамской свиньи плохо переваривает грубую пищу

На подворье, где выгуливаются свиньи, не должно быть ядовитых трав. К ним относятся:

  • вех ядовитый;
  • дурман;
  • чемерица;
  • лютик;
  • паслен;
  • горчица.

Растения, которых не должно быть во дворе

Корма всегда должны быть свежими, без признаков гниения и плесени. Нельзя оставлять влажные мешанки дольше, чем на 2–3 часа. Перед каждым приемом пищи емкости для корма очищают от остатков пищи и загрязнений. 3 раза в месяц кормушки и поилки обдают кипятком.

Сразу после появления на свет поросят выпаивают теплой прокипяченной водой. В нее добавляют марганцовку, чтобы получился бледно-розовый раствор. Не менее полезны отвары злаков — овса, риса, а также семян льна.

В свинарнике регулярно убирают. Влага, грязь, холод способствуют распространению инфекционных заболеваний. Каждый год стены белят известью. Дважды в неделю загоны подлежат дезинфекции. Подстилку меняют ежедневно.

Периодически поросятам дают витаминные комплексы и рыбий жир. Для предупреждения диареи и анемии в пятидневном возрасте делают инъекции препаратов на основе железа — Ферродекс, Ферроглюкин.

Кормушки и поилки свиней надо содержать в чистоте

Понос — опасное явление для любого животного, вызывающее обезвоживание. Если нехватка влаги возникла в организме новорожденного поросенка, то это приводит к его гибели. Поэтому начинать лечение при подобных состояниях нужно как можно раньше.

Чем лечить понос у поросят в домашних условиях: лекарственные и народные средства

Неокрепшие поросята требуют особого внимания, при транспортировке на новое место малыши испытывают стресс, не сразу привыкают к другим условиям. Резкое изменение рациона, питьевой воды провоцирует развитие кишечных расстройств, и если не знать, чем лечить в домашних условиях поросят от поноса, можно остаться без молодняка. У животных младше месяца болезни протекают очень тяжело, при отсутствии своевременной помощи ослабевшие малыши погибают.

Причины расстройства желудка у свиней

От поноса, который возникает при нарушении функционирования кишечника, страдают и маленькие детеныши, и крупные животные. Когда диарея сопровождается ростом температуры, рвотой, вместе с испражнениями из организма выходят соли и компоненты, без которых мозг, нервы, сердечная мышца прекращают выполнять функции. В течение нескольких часов после появления поноса необходимо выяснить причину такого состояния и начать лечение.

У взрослых особей

Диарея у свиней возникает при заражении инфекционной болезнью, при употреблении заплесневевшей пищи, гнилых продуктов. Провоцируют расстройство:

  • грязная вода;
  • резкая смена корма;
  • заглатывание твердых предметов;
  • отравление токсинами.

Серый стул появляется при нарушении работы желудка, белесый — при поражении печени. Диарея с желтым жидким калом говорит о сбоях в моторике кишечника. Понос со сгустками красного цвета у свиней наблюдается при кровотечениях в пищеварительных органах.

У поросят

Диарея у маленьких животных возникает при содержании во влажном и грязном помещении, где быстро размножаются бактерии, патогенные грибки. Способствует появлению диареи:

  • отлучка молодняка от молока свиноматки;
  • дефицит микроэлементов и витаминов в корме;
  • переедание или голодание;
  • неправильный уход.

У сосунов расстройство желудка развивается при воспалении у свиноматки молочных желез. У 10-дневных детенышей диарея появляется, когда у самки, которая кормит их, начинается влечение к особи мужского пола.

Подросшие поросята поносят при попадании с пищей и отходами инфекции, при употреблении свежей травы, которая плохо переваривается кишечником, при переводе на новый корм, при несбалансированном питании. За молодняком необходимо постоянно присматривать. Если поросята запоносили, следует срочно принимать меры.

Дополнительные симптомы

При расстройстве желудка испражнения у животных приобретают жидкую консистенцию, произвольно текут из заднего прохода. Состояние у подвижного поросенка ухудшается, он перестает двигаться и ложится на бок, становится вялым, теряет аппетит. При отравлении у свиньи, кроме появления поноса:

  • краснеют глаза;
  • растет температура;
  • из ушных раковин выделяется секрет.

Провоцируют возникновение диареи гельминты. При инвазии глистами животное кашляет, хрипит, не набирает вес, иногда ведет себя агрессивно.

Диагностические мероприятия

При расстройстве желудка владелец поросят может самостоятельность определить причину поноса по запаху и окраске кала, присутствию дополнительных симптомов. Водянистые выделения появляются при проблемах в пищеварительных органах, если они пенятся, биологический материал нужно сдавать на исследование, результаты которого помогут ветеринару определить вид заразной болезни.

Основные методы лечения поноса

Расстройство желудка у свиней проходит самостоятельно очень редко и то, если связано с перееданием, со сменой рациона. При появлении поноса у поросят нельзя допускать обезвоживания. До приезда ветеринара необходимо напоить животных раствором «Регидрона». Пакет порошка высыпают в литр слегка нагретой воды и дают жидкость поросятам по 200 мл минимум 5 раз.

Если лекарства дома не оказалось, в стакан кладут по 1 ч. л. поваренной соли и сахара, заливают остывшим кипятком. Хлористый калий молодняку дают перед каждым кормлением, что делают до 3 раз в сутки.

Аптечные препараты

После оказания первой помощи и выявления патогенных микроорганизмов в биоматериале ветеринар рекомендует лечить молодняк антибиотиками. Обычно советуют:

  1. «Бровафарм» соединять с жидкостью или кашей, на 1 кг веса брать 20 г порошка, кормить от 2 раз в сутки.
  2. «Аколан» нужно вводить внутрь по подобной схеме.
  3. «Биовит» следует давать малышам с месяца по 50 мг, с 2 до 6 — по 3 г, для взрослых свиней дозировку увеличивать в 2,5 раза.

Вместе с медикаментами для устранения поноса применяют активированный уголь или «Смекту». Сорбенты очищают от токсинов, скопившейся пищи.

«Бровасептол» и «Амоксициллин» чаще используются в уколах, которые делают внутримышечно. Курс антибактериальной терапии продолжается от 3 до 5 дней.

При инфекционном поносе у поросят вьетнамской породы применяют другие антибиотики. «Фуразолидон» животным дают в дозировке, рассчитываемой на 1 кг веса по 3 г, «Тетрациклин» — по 40. «Фармазин» молодняку колют внутримышечно. Спазмы у животных снимают клизмами с водой, в которую добавляют марганцовокислый калий, делают теплые компрессы, прибегают к прогреванию лампой Соллюкс.

Народные средства

Если поросенок поносит не вследствие заразной болезни, а из-за переедания, перехода на новый корм, животное поят отварами или настоями из натуральных средств. Дубовая кора снимает воспаление, устраняет рвоту, обладает вяжущим свойством. Лечебный состав можно делать из 100 г сухого растительного вещества и 4 стаканов воды. Жидкость дают пить поросенку перед кормлением.

Цветки ромашки, липы, листья крапивы убивают микробы, очищают желудок и кишечник от токсинов, не переварившихся продуктов. Для приготовления настоя 4 ст. л. растительной смеси соединяют с литром воды, емкость накрывают крышкой и оставляют на 3–4 часа.

Лечебную жидкость вливают в рот поросенку до кормления. На 1 кг веса молодняка берется 2 ч. л. средства. При поносе зеленого цвета в пищу животному добавляют 5 мл настойки из хвои на спирту, в которой содержатся полезные компоненты. Если в жидких испражнениях появляются сгустки крови, готовят рисовый отвар, который дает обволакивающий эффект.

Больных детенышей держат отдельно от здоровых свинок, переводят в теплое помещение, кладут сухую подстилку, которую меняют как минимум дважды в день. При появлении поноса свинке не дают пищу, поят водой, при улучшении состояния — рисовым отваром, в который добавляют несколько капель трескового жира, лекарственные средства, содержащие железо, витамины.

Профилактика диареи у поросят

Предупредить появление поноса у молодняка легче, чем такую проблему устранить. Свиноматкам необходимо своевременно вводить вакцины, предупреждающие кишечные болезни. Новорожденных детенышей нужно поить слабым и теплым раствором перманганата калия, содержать в теплом и сухом помещении, привить от глистов.

Чтобы избежать появления диареи:

  • Кормить поросят надо по времени.
  • Осторожно добавлять новые свежие продукты.
  • Пищу давать в измельченном виде.
  • Следить за тем, чтобы молодняк не переедал.

В рационе животных должны быть и витамины, и минералы. Свинарник нужно регулярно убирать, проветривать, малышей выгуливать на свежем воздухе, содержать в чистоте поилки, кормушки.

Передаются правильные антитела: защита поросят от диареи

Первое молоко дает поросятам важные антитела. Предоставлено: Vetmeduni Vienna / Worliczek.

Паразит Cystoisospora suis поражает молочных свиней, вызывая серьезные кишечные проблемы, такие как диарея. Ученые Венского университета ветеринарной медицины (Vetmeduni) доказали, что антитела против Cystoisospora suis передаются от матери к поросятам через молоко.Однако неожиданно оказалось, что антитела не защищают животных очень эффективно. Результаты представлены в текущем номере журнала Veterinary Parasitology .

Как и человеческие младенцы, у новорожденных поросят слабо развита иммунная система, хотя обычно считается, что их устойчивость к болезням чрезвычайно важна для их выживания и роста. В отличие от человеческих младенцев, поросята не получают антител через плаценту, поэтому они даже больше, чем люди, зависят от антител, переносимых в молозиве, первом молоке, которое вырабатывается матерью при родах.В течение первых нескольких часов после рождения их кишечные стенки достаточно проницаемы, поэтому крупные белки, такие как антитела, могут попадать в кровоток и передаваться в разные органы.

Одной из наиболее частых причин неонатальной диареи у поросят является кокцидиоз, тяжелое паразитарное заболевание кишечного тракта, вызываемое одноклеточным организмом Cystoisospora suis. Кокцидиоз связан с обширным разрушением слизистой оболочки кишечника и, следовательно, с менее эффективным потреблением пищи, что приводит к снижению прибавки в весе и экономическим потерям для фермеров.Заражение Cystoisospora suis приводит к тяжелой диарее и может привести к летальному исходу при наличии вторичных бактериальных инфекций. По соображениям благополучия животных, а также по экономическим причинам существует значительный интерес в попытках контролировать болезнь.

Проблемой занимается младшая исследовательская группа Института паразитологии Ветмедуни, возглавляемая Ханной Ворличек. Авторы исследования Лукас Шварц и его коллеги изучили уровни антител против Cystoisospora suis, которые передаются поросятам в молозиве.Ученые смогли показать, что свиноматки действительно передают антитела против Cystoisospora через молозиво: материнские IgA, IgG и IgM были обнаружены в крови поросят в течение нескольких часов после рождения. Хотя высокие уровни так называемых антител IgG сохранялись в течение всех четырех недель исследования, другие материнские антитела исчезли в течение 2-3 недель, и к этому времени поросята вырабатывали свои собственные антитела.

Взрослые свиньи приобретают антитела против Cystoisospora suis в результате естественного заражения паразитом, от которого они обычно могут избавиться, не проявляя никаких симптомов.Однако удивительно, что эти антитела, похоже, не защищают поросят от клинических признаков кокцидиоза. Как говорит Уорличек: «Возможно, свиноматки были инфицированы давным-давно, и у них больше не осталось антител, достаточных для защиты их поросят от болезни».

Интересно, что новая работа предполагает, что антитела IgA участвуют в иммунном ответе на инфекцию Cystoisospora: поросята с более высокими уровнями материнских антител IgA страдали менее тяжелой диареей, чем поросята с более низкими концентрациями IgA.Исследователи Vetmeduni оптимистично настроены в отношении того, что лучшее понимание иммунной реакции против Cystoisospora suis приведет к лучшим защитным мерам. Ворличек объясняет, что «уровни антител IgA к Cystoisospora могут обеспечить хороший коррелят защиты от неонатальной инфекции, вызванной паразитом. Теперь нам нужно найти способы повысить уровень IgA свиноматок и посмотреть, повлияют ли они на более здоровых поросят».


Здоровые поросята? Не с сульфаниламидами
Дополнительная информация: Шварц, Л., Иоахим, А. и Ворличек, Л., Передача колостральных антител, специфичных к Cystoisospora suis, и их корреляция с течением неонатального цистоизоспороза свиней, Ветеринарная паразитология . dx.doi.org/10.1016/j.vetpar.2013.07.007 Предоставлено Венский медицинский университет

Ссылка : Передача нужных антител: защита поросят от диареи (2013, 20 августа) получено 27 ноября 2020 с https: // физ.org / news / 2013-08-antibodies-piglets-diarrhea.html

Этот документ защищен авторским правом. За исключением честных сделок с целью частного изучения или исследования, никакие часть может быть воспроизведена без письменного разрешения. Контент предоставляется только в информационных целях.

.

Исследование посвящено обезболиванию поросят с помощью лечебного материнского молока

Обезболивание у кормящих поросят, подвергающихся определенным процедурам, является предметом исследования исследователей из Университета штата Канзас. Предоставлено: Университет штата Канзас.

Новые данные исследователей из Колледжа ветеринарной медицины Канзасского государственного университета предполагают возможное облегчение боли у поросят путем введения лекарств в процессе кормления.

Научная методология формально называется «трансмаммарная доставка».«Основная концепция заключается во введении свиноматке обезболивающего лекарства, которое могут проглотить поросята свиноматки с молоком.

Ханс Кутзее, заведующий кафедрой анатомии и физиологии Колледжа ветеринарной медицины, и его сотрудник являются главными исследователями многопрофильной исследовательской группы.

«В свиноводстве поросята регулярно подвергаются болезненным процедурам, таким как купирование хвоста и кастрация, которые стали новой проблемой для защиты животных», - сказал Кутзи.«Мы предположили, что трансмаммарная доставка нестероидного противовоспалительного препарата или НПВП - в данном случае фирококсиба - уменьшит боль, связанную с переработкой у поросят. Наши результаты показали, что этот метод может безопасно снизить стресс, вызванный переработкой, и повысить продуктивность за счет увеличения отъема веса ".

Команда

Кутзи состояла из исследователей из Института вычислительной сравнительной медицины и факультета математики Университета штата Айова, Университета штата Айова и Midwest Veterinary Services Inc., последним управляет Келли Лехтенберг, выпускница колледжа ветеринарной медицины 1987 года. Его исследование финансировалось Национальным советом по свинине, грант № 16-118.

Помимо болеутоляющего эффекта для поросят, Coetzee рассматривает потенциальную пользу для матерей.

«Дополнительные крупномасштабные исследования могут быть сосредоточены на изменениях в потреблении корма, массе тела и составе молока у свиноматок, принимающих фирококсиб», - сказал Кутзи. «Таким образом, мы могли определить, улучшает ли НПВП благополучие свиноматок в дополнение к влиянию на благополучие кормящих поросят.«

Исследование было опубликовано в журнале Journal of Animal Science , «Трансмаммарная доставка фирококсиба поросятам снижает стресс и улучшает среднесуточный прирост после кастрации, купирования хвоста и стрижки зубов».


Ветеринары доставляют поросятам обезболивающее через молоко свиноматки
Дополнительная информация: Johann F Coetzee et al.Трансмаммарная доставка фирококсиба поросятам снижает стресс и улучшает среднесуточный привес после кастрации, купирования хвоста и стрижки зубов1, Journal of Animal Science (2019). DOI: 10.1093 / jas / skz143 Предоставлено Канзасский государственный университет

Ссылка : Исследование посвящено обезболиванию поросят с помощью лечебного материнского молока (2019, 17 июня) получено 27 ноября 2020 с https: // физ.org / новости / 2019-06-болеутоляющие-поросята-медикаменты-мать.html

Этот документ защищен авторским правом. За исключением честных сделок с целью частного изучения или исследования, никакие часть может быть воспроизведена без письменного разрешения. Контент предоставляется только в информационных целях.

.

Ветеринары доставляют поросятам обезболивающее через молоко свиноматки

На этих изображениях, сделанных с помощью термографической камеры, слева показан поросенок, получавший обезболивающее, а справа - поросенок, получавший плацебо. У поросенка справа более низкая черепная температура. Предоставлено: Ганс Кутзее.

Ветеринарные исследователи из Университета штата Айова изобрели новый способ доставки болеутоляющих поросят через молоко матери-свиноматки, которая кормила поросят.

Это экспериментальное исследование, которое может помочь производителям свинины снизить стресс и боль, которые испытывают кастрированные или удаленные хвосты поросят, без необходимости вводить каждому поросенку лекарство.

Ханс Кутзее, профессор ветеринарной диагностики и медицины производственных животных, сказал, что потребителей беспокоит обезболивание во время рутинных процедур животноводства.

Итак, Кутзи вместе с коллегами Локком Каррикером, адъюнкт-профессором ветеринарной диагностики и медицины производственных животных и научным сотрудником постдокторантуры Джессикой Бейтс, начали изучать возможность введения обезболивающих в корм свиноматке, которые затем передали бы ее ей. поросята через ее молоко.

Результаты годичного исследования, недавно опубликованные в академическом журнале PLOS ONE , показывают, что поросята, которые получают обезболивающее с молоком свиноматки с лекарственными препаратами, испытывают меньший стресс после кастрации и купирования хвоста, чем поросята, выкормленные от свиноматок, которые не получал лекарства.

«Мы хотели выяснить, можем ли мы доставлять лекарства поросятам пассивно, без необходимости обрабатывать и вводить каждое из них индивидуально», - сказал Кутзи. «Наши результаты, кажется, демонстрируют, что этот метод может кардинально изменить отношение к поросятам».

По его словам, практика удаления хвостов у поросят и кастрации самцов широко распространена в производстве свинины в США. Кастрация самцов до достижения ими половой зрелости предотвращает развитие у свинины неприятного вкуса, который в промышленности называют «кабаньим запахом».Это также снижает уровень агрессии, которую могут проявлять самцы свиней.

По словам Кутзи, стыковка

снижает вероятность того, что свиньи кусают хвосты своих сородичей, вызывая боль и потенциально серьезные травмы.

Европейский Союз требует, чтобы производители свинины давали поросятам обезболивающие перед проведением этих процедур, но Соединенные Штаты не приняли аналогичных мер. На самом деле, Управление по санитарному надзору за качеством пищевых продуктов и медикаментов не одобрило использование каких-либо обезболивающих для поросят, сказал Кутзи.

Итак, как исследователи узнают, что поросята, участвующие в исследовании, реагируют на лекарство? Кутзи сказал, что команда отслеживала уровень лекарства в образцах крови, взятых как у свиноматок, так и у поросят, участвовавших в исследовании. Они также использовали термографическую камеру для измерения изменений температуры кожи на головах поросят после кастрации и стыковки.

Изображения показали, что у поросят, выкармливающих свиноматок без лекарств, обычно наблюдается выраженное падение температуры поверхности вокруг головы, вероятно, в результате боли, вызывающей сужение кровеносных сосудов кожи и уменьшение кровотока.С другой стороны, поросята, которые получали обезболивающее через молоко, поддерживали более постоянную температуру поверхности кожи, что свидетельствует о том, что эти поросята подвергались меньшему стрессу, сказал Кутзи.

В своем исследовании исследователи использовали мелоксикам, нестероидное противовоспалительное средство, подобное аспирину. Кутзи сказал, что следующим шагом в исследовании будет определение самой низкой дозы лекарства, которую можно дать свиноматке, которая все еще дает желаемое количество обезболивания у поросят.

«Мы должны усовершенствовать процесс и сделать его рентабельным, потому что этот метод имеет огромный потенциал в оказании помощи свиноводству в устранении боли, связанной с рутинными процедурами управления», - сказал он. «Возможно, его можно использовать для других препаратов, которые производитель захочет использовать для лечения поросят».


Возраст отъема поросят Нет ограничений по частоте появления пометов
Дополнительная информация: «Влияние мелоксикама, доставляемого трансмаммарными препаратами, на биомаркеры боли и дистресса у поросят после кастрации и купирования хвоста»." PLoS ONE 9 (12): e113678. DOI: 10.1371 / journal.pone.0113678 Предоставлено Государственный университет Айовы

Цитата : Ветеринары доставляют поросятам обезболивающее через молоко свиноматки (2014, 10 декабря) получено 27 ноября 2020 с https: // физ.org / news / 2014-12-veterinary-pain-Medicine-piglets.html

Этот документ защищен авторским правом. За исключением честных сделок с целью частного изучения или исследования, никакие часть может быть воспроизведена без письменного разрешения. Контент предоставляется только в информационных целях.

.

Диарея путешественников | Johns Hopkins Medicine

Что такое диарея путешественника?

Понос - это жидкий или водянистый стул. Диарея путешественника возникает в течение 10 дней после поездки в район с плохой общественной гигиеной. Это самая распространенная болезнь у путешественников.

Что вызывает диарею путешественников?

Это вызвано употреблением воды или употреблением пищи, содержащей бактерии, вирусы или паразиты. У большинства путешественников диарея вызвана бактериями. Диарея от вирусов и паразитов встречается реже.Пища и вода могут заразиться от людей:

  • Не мыть руки после посещения туалета
  • Небезопасное хранение продуктов
  • Небезопасное обращение и приготовление пищи
  • Безопасная чистка поверхностей и посуды

Кто подвержен риску диареи путешественников?

Вы рискуете заболеть этим заболеванием, если вы путешествуете в страну с плохими санитарно-гигиеническими условиями. Плохая гигиена в местных ресторанах также является фактором риска. Места с наибольшим риском часто находятся в развивающихся странах в:

  • Африка
  • Азия
  • Центральная и Южная Америка
  • Ближний Восток

Если вы путешествуете в развивающуюся страну, у вас больше шансов заразиться этим заболеванием, если вы едите или пьете:

  • Купил на улице, например в тележке с едой
  • В чужом доме
  • В общежитии с полным питанием (все включено)

Вы также подвергаетесь повышенному риску, если:

  • Примите некоторые лекарства от язвы
  • Переносили операции на желудочно-кишечном тракте

Каковы симптомы диареи путешественника?

Основной симптом - внезапный жидкий стул.Стул может быть водянистым. Другие симптомы могут включать:

  • Тошнота
  • Рвота
  • Вздутие живота
  • Боль или спазмы в животе (животе)
  • Кровь в стуле
  • Проблемы с ожиданием дефекации (позывы)
  • Чувство усталости
  • Лихорадка

В большинстве случаев симптомы длятся менее недели.

Как диагностируется диарея путешественника?

Ваш лечащий врач спросит вас об истории вашего здоровья и симптомах.Он или она спросит о вашем недавнем путешествии. Вы также можете сделать посев кала или другие анализы. Посев кала проводится путем взятия небольшого образца стула. Затем его отправляют в лабораторию для проверки на наличие бактерий, вирусов и паразитов. Если ваши симптомы длятся более 10–14 дней, вам могут быть назначены другие тесты.

Как лечится диарея путешественников?

Понос у путешественников часто проходит через несколько дней. Часто единственным лечением является замещение жидкости. Вам могут посоветовать пить много жидкости. Это может быть прозрачный бульон, газированная вода или сок.Если симптомы не исчезнут, вам могут потребоваться антибиотики или другие лекарства.

Какие возможные осложнения диареи путешественника?

Потеря жидкости организма в результате диареи и рвоты может привести к обезвоживанию. Это может быть серьезно. Обратитесь к своему врачу, если вы не мочитесь так часто, как обычно.

У небольшого числа людей может развиться постинфекционный синдром раздраженного кишечника. Это может вызвать такие симптомы, как:

  • Длительная диарея
  • Боль и спазмы в животе
  • Вздутие живота

Что я могу сделать, чтобы предотвратить диарею путешественников?

Вы можете принять меры для предотвращения диареи путешественников.

Используйте только кипяченую или химически продезинфицированную воду для:

  • Питьевая
  • Приготовление чая или кофе
  • Чистить зубы
  • Умывание
  • Мытье рук (или использовать гель на спиртовой основе)
  • Мытье овощей и фруктов
  • Мытье посуды, оборудования или поверхностей
  • Мытье поверхностей консервных банок, банок и бутылок для еды и напитков

Не ешьте такие продукты, как:

  • Сырые фрукты, овощи или салатная зелень
  • Непастеризованное молоко, сыр, мороженое или йогурт
  • Сырое мясо
  • Моллюски
  • Любая рыба, пойманная не в открытом океане, а на тропических рифах
  • Приправы, оставленные на столе, например кетчуп, горчица, соусы или соусы

Также не забудьте:

  • Не употреблять пищу из неизвестных источников
  • Не кладите лед в напитки
  • Предлагайте напитки только в бутылках и запечатанных бутылках
  • Используйте соломинки для питья вместо питья непосредственно из стаканов или чашек
  • Принимайте антибиотики или противодиарейные лекарства только по рекомендации врача (они могут ухудшить симптомы, что может быть опасно).

Когда мне следует позвонить своему врачу?

Позвоните поставщику медицинских услуг, если вы:

  • У вас диарея тяжелая или с кровью
  • Боль в животе усиливается или не проходит
  • У меня высокая температура
  • Через несколько дней не станет лучше
  • Есть признаки обезвоживания, например, меньше мочеиспускания

Ключевые точки

  • Диарея путешественника возникает в течение 10 дней после поездки в район с плохой общественной гигиеной.Это самая распространенная болезнь у путешественников.
  • Это вызвано употреблением воды или употреблением в пищу продуктов, содержащих бактерии, вирусы или паразиты.
  • Обычно проходит без лечения в течение нескольких дней.
  • Обезвоживание из-за диареи может быть опасным. Вам необходимо восполнить потерю жидкости организма.
  • Обратитесь к врачу, если ваши симптомы серьезны или длятся более нескольких дней.
  • Вы можете предотвратить это, избегая небезопасной воды и небезопасных продуктов.

Следующие шаги

Советы, которые помогут вам получить максимальную пользу от визита к врачу:

  • Знайте причину вашего визита и то, что вы хотите.
  • Перед визитом запишите вопросы, на которые хотите получить ответы.
  • Возьмите с собой кого-нибудь, кто поможет вам задать вопросы и запомнить, что вам говорит поставщик.
  • Во время посещения запишите название нового диагноза и все новые лекарства, методы лечения или тесты.Также запишите все новые инструкции, которые дает вам ваш провайдер.
  • Узнайте, почему прописано новое лекарство или лечение и как они вам помогут. Также знайте, каковы побочные эффекты.
  • Спросите, можно ли вылечить ваше состояние другими способами.
  • Знайте, почему рекомендуется тест или процедура и что могут означать результаты.
  • Знайте, чего ожидать, если вы не примете лекарство, не пройдете тест или процедуру.
  • Если вам назначена повторная встреча, запишите дату, время и цель этого визита.
  • Узнайте, как вы можете связаться со своим поставщиком медицинских услуг, если у вас возникнут вопросы.
.

Рекомбинантный норовирус свиньи идентифицирован у поросенка с диареей

1 Шен и др. BMC Veterinary Research 2012, 8: 155 НАУЧНАЯ СТАТЬЯ Открытый доступ Рекомбинантный свиной норовирус, идентифицированный у поросят с диареей Quan Shen 1,3, Wen Zhang 1, Shixing Yang 1, Zhibiao Yang 1, Yan Chen 2, Li Cui 2, Jianguo Zhu 2 и Xiuguo Hua 2 * Аннотация: Норовирусы (NoV) являются членами семейства Caliciviridae и представляют собой новые кишечные патогены человека и животных.Некоторые новые свиньи генетически похожи на человеческие и классифицируются по GII, как и большинство эпидемических новых вирусов человека. До сих пор PoNoV был обнаружен исключительно в образцах фекалий взрослых свиней без клинических признаков. Результаты: результат показал, что 2 из 12 оцененных образцов фекалий были положительными на PoNoV, один из которых был положительным только на PoNoV, а другой был коинфицирован цирковирусом свиньи и PoNoV. Филогенетический и рекомбинационный анализ показал, что только положительный по PoNoV штамм был рекомбинантным штаммом нового генотипа.Экспериментальное заражение миниатюрных свиней фекальными суспензиями подтвердило, что этот штамм может вызывать гастроэнтерит у поросят. Заключение: это первое сообщение о том, что рекомбинантный новый генотип PoNoV существует в стаде свиней в Китае, что вызывает диарею у свиней в естественных условиях. Эта находка подняла вопросы о предполагаемой эпидемиологической роли PoNoV. Ключевые слова: норовирус свиней, рекомбинантный, новый генотип, гастроэнтерит. Предпосылки. Норовирусы (NoV) являются членами семейства Caliciviridae и представляют собой новые кишечные патогены человека и животных [1,2].Это небольшие вирусы без оболочки диаметром нм, обладающие одноцепочечной геномной РНК с положительным смыслом. Геном NoVs имеет длину kb и содержит 3 открытые рамки считывания (ORF) [3]. ORF1 кодирует полипротеин, который автокаталитически расщепляется с образованием нескольких белков, включая РНК-зависимую РНК-полимеразу (RdRp) и другие неструктурные белки [4]. ORF2 кодирует основной белок капсида, а ORF3 кодирует минорный структурный белок [5]. NoV были изолированы от людей и нескольких видов животных, включая свиней, собак, быков, мышей и львов [6-8].На основе анализа последовательностей, включающих консервативные области внутри RdRp и генов капсида, NoV делятся на 5 геногрупп (GI-GV) и далее подразделяются на 27 генотипов [9]. Человеческие новички находятся в giiandgiv.giicontains19genotypes и * Переписка: 2 Ключевая лаборатория ветеринарной биотехнологии, Школа сельского хозяйства и биологии, Шанхайский университет ЦзяоТун, 800 Dongchuan Road, Шанхай, Китайская Народная Республика. Полный список информации об авторах доступен по адресу: конец статьи Штаммы свиней встречаются в GII-11, -18 и -19 [10].Некоторые свиньи NoV генетически связаны со штаммами человека и классифицируются в GII, который содержит большинство эпидемических штаммов NoV у человека. Были идентифицированы некоторые потенциальные рекомбинантные штаммы NoV [10,11], что вызывает обеспокоенность общественного здравоохранения в отношении их возможности передачи зоонозов. На сегодняшний день PoNoV был обнаружен исключительно в образцах фекалий взрослых свиней без клинических признаков. Методы Образцы С мая по август на трех коммерческих свинофермах в пригороде Шанхая были собраны двенадцать образцов фекалий поросят с диареей без точной этиологии. Во избежание контаминации образцов образцы были взяты непосредственно из ануса свиньи, а одноразовые материалы были взяты. используется во время отбора проб.Образцы стула были недавно собраны и немедленно преобразованы в 10% (мас. / Об.) Суспензии в PBS (0,01 M фосфат, ph, 0,15 M NaCl) для экстракции РНК и ДНК. Shen et al .; лицензиат BioMed Central Ltd. Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License (которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии правильного цитирования оригинальной работы.

2 Shen et al. BMC Veterinary Research 2012, 8: 155 Стр. 2 из 6 Экстракция РНК и ДНК РНК экстрагировали из 200 мкл 10% фекальной суспензии с использованием реагента TRIzol (Invitrogen, США) в соответствии с инструкциями производителя.Осадки РНК растворяли в 25 мкл воды, свободной от РНКазы, и немедленно выполняли обратную транскрипцию. ДНК экстрагировали с помощью набора QIAamp DNA Stool Mini (QIAGEN, Германия) в соответствии с инструкциями производителя. ОТ-ПЦР или ПЦР ОТ-ПЦР или ПЦР-анализы с различными наборами праймеров для обнаружения PoNoV и распространенных вирусов, которые могут вызывать диарею свиней, включая цирковирус свиней типа 2, ротавирус свиней, вирус трансмиссивного гастроэнтерита свиней, саповирус свиней и эпидемическую диарею свиней вируса выполняли, как описано ранее [12-14].Ампликоны анализировали электрофорезом в 1% агарозном геле в буфере TAE с последующим окрашиванием бромидом этидия (0,5 мкг / мл) и визуализацией в УФ-свете. Амплификация всего генома Концевой фрагмент pnovs-ch6 размером 3 т.п.н. амплифицировали с праймерами p290 и VN3T20 [10]. Для амплификации оставшейся последовательности были сконструированы 6 наборов праймеров (таблица 1) на основе всей последовательности генома PoNoV (AB126320), доступной в GenBank. Обратную транскрипцию проводили при 42 ° C в течение 1 ч с 1 мкл (200 единиц) обратной транскриптазы AMV (TakaRa, Япония) и 1 мкл (25 мм) антисмыслового праймера.Параметры ПЦР всех реакций амплификации включали начальную инкубацию при 95 ° C в течение 5 мин, затем 39 циклов денатурации при 94 ° C в течение 1 мин, отжиг в течение 1 мин при температуре, изменяемой в зависимости от Tm различных праймеров, и удлинение при 72 ° C в течение 1,5 мин, с последней инкубацией при 72 ° C в течение 7 мин. Продукты ПЦР очищали с помощью набора для экстракции ДНК из геля Axyprep (AXYGEN, США). Очищенные продукты ПЦР лигировали в вектор PMD18-T (TakaRa, Япония) с использованием ДНК-лигазы Т4 (TakaRa, Япония) при 16 ° C в течение 2 часов.Рекомбинантную плазмиду трансформировали в компетентные клетки Escherichia coli DH5α (TakaRa, Япония). Были секвенированы три положительных клона. Анализ последовательностей и рекомбинации Поиск сходства последовательностей проводился в BLAST (после множественного выравнивания с CLUSTAL W (версия 1.4) филогенетическое родство штаммов в настоящем исследовании и эталонных изолятов оценивали с помощью программного обеспечения MEGA Version 4.0. Для анализа в MEGA использовалось расстояние Jukescantor (JC) с использованием алгоритма Neighbor Joining (NJ) [15].Достоверность различных филогенетических группировок оценивалась с помощью теста начальной загрузки (1000 повторений начальной загрузки), доступного в MEGA. Идентификации рекомбинантов были Таблица 1 Праймеры, предназначенные для усиления оставшейся последовательности pnovs-CH6 Имени Праймера Нуклеотидной нуклеотиды в положении последовательности () PNoV1F ACCTGTCCCTACAGTGGATG PNoV1R ATATGAGTTTTGCCTATACC PNoV2F ATCTCAGCAGCCAGGTCGCTCC PNoV2R AACCCATACCTATTGTCAGC PNoV3F TCTACAACTTCGATGTGGAC PNoV3R TGACGGAGTCTCATCTCATC PNoV4F CGAGGAGTACCTCCGTGAC PNoV4R TGATTCTCACCACCCTCCAG PNoV5F ACTCAGGGTCCTGATGGTG PNoV5R TGCCTCTCTGTTGGGTGGAG PNoV6F ATACCTACCACTTTGATGC PNoV6R ATGAGGCTTCTCCCAGCAGG 5 0 endf 1-23 GTGAAATGAAGATGGCGTCTAAC 5 0 endr ATAGAATCACGTTGGCAACC 3 0 endf1 (внешний прямой праймер ACTGGAATGGCACGAGATACTGG) 5 0 endf2 (внутренний ACTCTATGGGTACCTCTIG для прямого праймера нуклеотида TTTu и нуклеотидного конца TTTT)Положение нуклеотидов соответствует AB. В названиях праймеров F и R означают смысловой праймер и антисмысловой праймер соответственно. выполняется с помощью программы обнаружения рекомбинации ([16]. Прототип штаммов NoVs, используемых в качестве эталонов в анализе, их инвентарные номера в GenBank и источник происхождения отмечены на филогенетическом дереве (рис. 1). Животные Восемь 15-дневных специфических патогенов Миниатюрные свиньи, не содержащие патогенов (SPF), были приобретены в Центре экспериментальных животных Школы сельского хозяйства и биологии Шанхайского университета Цзяотун (Шанхай, Китай) и содержались в помещении для животных, свободных от патогенов.Этот эксперимент на животных был одобрен IACUC с номером разрешения IACUC-2009-S-0202, который соответствует Руководству Национального института здравоохранения по уходу и использованию лабораторных животных. Экспериментальная инфекция Образец кала pnovs-ch6 был преобразован в суспензию 20% (вес. / Об.) В фосфатно-солевом буфере (PBS) (0,01 M, ph 7,4) и осветлен центрифугированием при 10000 g в течение 10 мин. Затем супернатант очищали пропусканием через микрофильтры с размером пор 0.22 мкм (Millipore, Япония) для удаления возможных бактерий и паразитов. Аликвоту супернатанта объемом 1,5 мл использовали для инфицирования пяти 15-дневных

3 Shen et al. BMC Veterinary Research 2012, 8: 155 Стр. 3 из 6 Рис. 1 Филогенетический анализ аминокислотных последовательностей pnovs-ch6 и других NoV. Значения начальной загрузки, выраженные в процентах от 1000 репликаций, указаны в точках ветвления. Номера доступа GenBank для эталонных штаммов отмечены в каждой точке ветвления.Дерево (A) было построено на основе всей области капсида. Дерево (B) было построено на основе области RdRp. Обозначение штаммов соответствует схеме Wang et al. [10] и Zheng et al. [9]. старые поросята путем пероральной инокуляции. Еще три поросенка были инокулированы только PBS в качестве контроля. Поросят обследовали каждые 4 часа в течение первого дня, и образцы фекалий собирали у каждого поросенка каждый день. В экспериментальной группе один поросенок был умерщвлен в сутки после инокуляции (PID) 1, 2, 4, 6, 10; тем временем, один был умерщвлен при PID 1, 4, 10 для контрольной группы.Содержимое кишечника собирали для тестирования РНК с помощью ОТ-ПЦР, и сегменты кишечника вырезали и немедленно погружали в различные фиксаторы для гистологического исследования. Ткани для гистологического исследования фиксировали в 10% нейтральном забуференном формалине, регулярно обрабатывали, делали срезы толщиной 7 мкм и окрашивали гематоксилином и эозином. Срезы тканей исследовали и сравнивали с отрицательными контролями.

4 Шен и др.BMC Veterinary Research 2012, 8: 155 Стр. 4 из 6 Результаты Результат обнаружения PoNoV Результат обнаружения показал, что два фекальных образца были положительными на PoNoV, один из которых был коинфицирован цирковирусом свиней. Остальные были отрицательными на PoNoV, цирковирус свиней типа 2, ротавирус свиней, вирус трансмиссивного гастроэнтерита свиней, саповирус свиней и вирус эпидемической диареи свиней. Образец кала, положительный только на PoNoV, был выбран для дальнейшей амплификации генома и экспериментального заражения.Анализ организации генома и рекомбинации. Полный геном этого штамма PoNoV (названного pnovs-Ch6, инвентарный номер GenBank: HQ392821) состоял из 7531 нуклеотида, за исключением поли (A) хвоста. Подобно ранее описанным штаммам NoVs, pnovs-ch6 имеет три открытые рамки считывания (ORF), кодирующие 1693, 547 и 253 аминокислоты (аа) соответственно. Он имел 88% нуклеотидную гомологию с AB по всей последовательности генома. Наивысшая нуклеотидная гомология по сравнению с последовательностью RdRp была у AB (89%), а затем у американского штамма свиней AY (88%).Филогенетическое дерево, основанное на предсказанной аминокислотной последовательности полной области капсида, показало, что pnovs-Ch6 был отделен от известных штаммов GII свиней (GII-11, GII-18 и GII-19), образуя новую ветвь самостоятельно (Рисунок 1A). , что предполагает, что этот штамм может представлять новый генотип в группе GII. Однако филогенетический анализ, основанный на области RdRp, дал другой результат группировки, где pnovs-ch6 был сгруппирован в кластер GII-11 (рис. 1B). Это открытие предполагает, что этот штамм вируса может одновременно быть рекомбинантным.Чтобы подтвердить обнаружение и обнаружить точку останова, где произошло событие рекомбинации, мы выполнили анализ рекомбинации на основе 30-концевого RdRp и последовательности капсида pnovs-ch6 в качестве запрашиваемой последовательности и AY823303 / GII-11 и AY823306 / GII- 19 в качестве фона. последовательности с использованием программного обеспечения RPD. Результаты показали, что точка разрыва расположена в области соединения RdRpcapsid, а основным родительским элементом был AY (Рисунок 2). Второстепенный родитель не был найден, что может быть связано с ограниченным количеством последовательностей NoVs, доступных в GenBank, хотя AY имел высокое сходство с запросным штаммом по короткому фрагменту (рис. 2).Экспериментальное заражение миниатюрных свиней фекальными суспензиями, положительными по PoNoV. Наши результаты показали, что у всех пяти поросят в экспериментальной группе наблюдались явные симптомы легкой и умеренной диареи при ВЗОМТ. Клинические признаки сохранялись от 2 до 6 дней, и ни один поросенок не погиб. Все пробы фекалий и кишечное содержимое поросят опытной группы были положительными на РНК NoVs. Атрофия ворсинок от легкой до умеренной, от легкой до умеренной и многоочаговое слияние ворсинок наблюдались в тонком кишечнике свиней экспериментальной группы, которые были подвергнуты эвтаназии от PID 6 до PID 10 (рис. 3).У трех поросят в контрольных группах не было никаких клинических симптомов и отрицательный результат на РНК NoVs. Обсуждение NoVs были обнаружены у широкого круга видов, включая людей, свиней, мышей, коров и львов. Поскольку PoNoV генетически и антигенно связаны с человеческими NoV GII, существуют проблемы общественного здравоохранения, связанные с потенциальной межвидовой передачей и животными-резервуарами для NoV, связанных с человеческими NoV [10,17]. До сих пор PoNoV был обнаружен исключительно в образцах фекалий взрослых свиней без клинических признаков [18,19], хотя в экспериментах с гнотобиотическими поросятами наблюдалась легкая диарея [10].В текущем исследовании сообщалось о гастроэнтерите у поросят, вызванном штаммом PoNoV. Экспериментальное заражение миниатюрных свиней фекальными суспензиями, положительными по PoNoV, подтвердило, что этот штамм вируса может вызывать гастроэнтерит у свиней. Насколько нам известно, это исследование является первой идентификацией штамма PoNoV, который вызывает гастроэнтерит у поросят в условиях, близких к естественным. Геном РНК-вирусов часто подвергается рекомбинации и сегментации [20]. Рекомбинация - движущая сила вирусной эволюции, о ней сообщалось для многих одноцепочечных РНК-вирусов, включая NoV.Сообщалось, что рекомбинация вируса гриппа приводит к образованию нового штамма и увеличивает биологическую пригодность вируса и его патогенность [1]. Предыдущие отчеты показали, что в геноме NoV рекомбинация в основном происходит в точке соединения ORF1 и ORF2, которая называется «горячей точкой» [21–23]. Результаты филогенетического анализа и идентификации рекомбинации показали, что pnovs-ch6 был рекомбинантным штаммом, и точка разрыва расположена в области соединения RdRp-капсид, как и большинство других событий рекомбинации NoV.Насколько нам известно, это первое сообщение о рекомбинантном PoNoV в Китае. Обнаружение PoNoV, который может вызвать гастроэнтерит у поросят из коммерческих свиноводческих хозяйств в естественных условиях, с одной стороны, поднимает вопросы о предполагаемой эпидемиологической роли PoNoV, а, с другой стороны, этот вид инфекционного штамма также может быть использован для улучшения такие исследования, как репликация вируса, разработка вакцины, которой препятствует отсутствие системы культивирования клеток для размножения новых вирусов человека.Увеличивает ли рекомбинация вирулентность PoNoV, все еще требует дальнейшего исследования. Заключение В заключение, результаты этого исследования продемонстрировали, что рекомбинантный новый генотип PoNoV существует у свиньи

5 Shen et al. BMC Veterinary Research 2012, 8: 155 Страница 5 из 6 Рис. 2 Идентификация рекомбинантного штамма pnovs-ch6. BOOTSCAN свидетельствует о происхождении рекомбинации на основе попарного расстояния, смоделированного с размером окна 200, размером шага 25 и 100 повторениями Bootstrap.Рис. 3. Гистологические поражения двенадцатиперстной кишки или тощей кишки у поросят после пероральной инокуляции NoV или PBS. Окраска гематоксилином и эозином. А, нормальные длинные ворсинки двенадцатиперстной кишки свиньи, инокулированной PBS; B - ворсинки двенадцатиперстной кишки, демонстрирующие легкую атрофию ворсинок от свиньи, инокулированной NoVs; C - нормальные длинные ворсинки тощей кишки свиньи, инокулированной PBS; D - ворсинки тощей кишки, демонстрирующие легкую атрофию ворсинок от свиней, привитых NoV. Бар = 10 мкм.

6 Шен и др.BMC Veterinary Research 2012, 8: 155 Стр. 6 из 6 стада в Китае, которые вызывают диарею у свиней в естественных условиях. Эта находка подняла вопросы о предполагаемой эпидемиологической роли PoNoV. Вклад авторов Автор Цюань Шэнь, Вэнь Чжан, Шиксин Ян, Ян Чен, Чжибяо Ян и Ли Цуй провели эксперименты. Авторы Сюгуо Хуа, Цюань Шэнь и Вэнь Чжан разработали эксперименты. Цюань Шэнь и Вэнь Чжан провели анализ и интерпретацию данных. Куан Шэнь написал рукопись. Все авторы одобряют отправку этой рукописи в BMC Veterinary Research.Благодарности Мы благодарим Келли Шойер за помощь в лингвистической редакции рукописи. Работа выполнена при поддержке грантов Национального фонда естественных наук Китая № и №, ключевого проекта Шанхайского комитета по науке и технологиям Китая в рамках гранта № 10JC, Фонда естественных наук провинции Цзянсу № BK, Фонда исследований для докторской программы. высшего образования Китая №, и Фонд профессиональных исследований перспективных талантов Университета Цзянсу. Подробная информация об авторе 1 Школа медицинских наук и лабораторной медицины, Университет Цзянсу, 301 Xuefu Road, Zhenjiang, Jiangsu, Китайская Народная Республика.2 Основная лаборатория ветеринарной биотехнологии, Школа сельского хозяйства и биологии, Шанхайский университет ЦзяоТун, 800 Dongchuan Road, Шанхай, Китайская Народная Республика. 3 Программа исследований здоровья животных в области пищевых продуктов, Центр сельскохозяйственных исследований и разработок Огайо, Государственный университет Огайо, Вустер, Огайо, США. Получено: 6 января 2011 г. Принято: 22 августа 2012 г. Опубликовано: 3 сентября 2012 г. Ссылки 1. Филдс Б.Н., Книп Д.М., Хоули П.М.: Вирусология полей. 5-е издание. Филадельфия; Лондон: Wolters Kluwer Health / Lippincott Williams & Wilkins; Лю Б.Л., Лэмбден П.Р., Гюнтер Х., Отто П., Эльшнер М., Кларк И.Н.: Молекулярная характеристика кишечного калицивируса крупного рогатого скота: связь с вирусами, подобными норволкскому.J Virol 1999, 73 (1): Jiang X, Wang M, Wang K, Estes MK: Последовательность и геномная организация норвалкского вируса. Virology 1993, 195 (1): Сосновцев С.В., Беллиот Дж., Чанг К.О., Приходько В.Г., Текрей Л.Б., Wobus CE, Karst SM, Virgin HW, Green KY: Карта расщепления и протеолитический процессинг неструктурного полипротеина норовируса мыши в инфицированных клетках. J Virol 2006, 80 (16): Беллиот Г., Сосновцев С. В., Митра Т., Хаммер С., Гарфилд М., Грин К. Ю.: Протеолитический процессинг in vitro неструктурного полипротеина ORF1 норовируса MD145 дает стабильные предшественники и продукты, аналогичные тем, которые обнаруживаются в калицивирусах. инфицированные клетки.J Virol 2003, 77 (20): Mattison K, Shukla A, Cook A, Pollari F, Friendship R, Kelton D, Bidawid S, Farber JM: Норовирусы человека у свиней и крупного рогатого скота. Emerg Infect Dis 2007, 13 (8): Martella V, Campolo M, Lorusso E, Cavicchio P, Camero M, Bellacicco AL, Decaro N, Elia G, Greco G, Corrente M и другие: Норовирус у львенка в неволе (Panthera Лео). Emerg Infect Dis 2007, 13 (7): Martella V, Lorusso E, Decaro N, Elia G, Radogna A, D Abramo M, Desario C, Cavalli A, Corrente M, Camero M и др.: Обнаружение и молекулярная характеристика собачий норовирус.Emerg Infect Dis 2008, 14 (8): Zheng DP, Ando T, Fankhauser RL, Beard RS, Glass RI, Monroe SS: Классификация норовирусов и предлагаемая номенклатура штаммов. Virology 2006, 346 (2): Ван К. Х., Хан М. Г., Читам С., Соуза М., Фанк Дж. А., Саиф Л. Дж.: Норовирусы свиней, связанные с норовирусами человека. Emerg Infect Dis 2005, 11 (12): Farkas T, Nakajima S, Sugieda M, Deng X, Zhong W, Jiang X: Серопространственность норовирусов у свиней. J Clin Microbiol 2005, 43 (2): Jiang X, Huang PW, Zhong WM, Farkas T., Cubitt DW, Matson DO: Дизайн и оценка пары праймеров, которая выявляет калицивирусы Norwalk и саппороподобные с помощью RT-PCR.J. Virol Methods 1999, 83 (1 2): Jeong C, Park SI, Park SH, Kim HH, Park SJ, Jeong JH, Choy HE, Saif LJ, Kim SK, Kang MI и др.: Генетическое разнообразие саповирусов свиней. Vet Microbiol 2007, 122 (3 4): Ян Дж. С., Сонг Д. С., Ким С. Ю., Лю К. С., Парк Б. К.: Обнаружение цирковируса свиней типа 2 в фекалиях свиней с кишечным заболеванием или без него с помощью полимеразной цепной реакции. J Vet Diagn Invest 2003, 15 (4): Kumar S, Tamura K, Nei M: MEGA3: интегрированное программное обеспечение для анализа молекулярной эволюционной генетики и выравнивания последовательностей.Brief Bioinform 2004, 5 (2): Martin D, Rybicki E: RDP: обнаружение рекомбинации среди выровненных последовательностей. Bioinformatics 2000, 16 (6): Guo M, Chang KO, Hardy ME, Zhang Q, Parwani AV, Saif LJ: Молекулярная характеристика кишечного калицивируса свиней, генетически связанного с калицивирусами человека, подобными саппоро. J Virol 1999, 73 (11): van Der Poel WH, Vinje J, van Der Heide R, Herrera MI, Vivo A, Koopmans MP: Norwalk-like calicivirus гены у сельскохозяйственных животных. Emerg Infect Dis 2000, 6 (1): Scipioni A, Mauroy A, Vinje J, Thiry E: Норовирусы животных.Vet J 2008, 178 (1): Domingo E, Holland JJ: Мутации РНК-вируса и приспособленность к выживанию. Annu Rev Microbiol 1997, 51: Ambert-Balay K, Bon F, Le Guyader F, Pothier P, Kohli E: Характеристика новых рекомбинантных норовирусов. J Clin Microbiol 2005, 43 (10): Bull RA, Hansman GS, Clancy LE, Tanaka MM, Rawlinson WD, White PA: рекомбинация норовирусов при перекрытии ORF1 / ORF2. Emerg Infect Dis 2005, 11 (7): Jiang X, Espul C, Zhong WM, Cuello H, Matson DO: Характеристика нового калицивируса человека, который может быть встречающимся в природе рекомбинантным.Arch Virol 1999, 144 (12): doi: / Цитируйте эту статью как: Шен и др.: Рекомбинантный норовирус свиньи, идентифицированный у поросят с диареей. BMC Ветеринарные исследования: 155. Отправьте свою следующую рукопись в BioMed Central и воспользуйтесь всеми преимуществами: Удобной онлайн-подачи. Тщательная рецензия. Отсутствие ограничений по месту или платы за цветные рисунки. Немедленная публикация при принятии. Включение в PubMed, CAS, Scopus и Google Scholar Research, которые свободно доступны для распространения. на

.

Карточки с лекарствами для свиней

Срок
Определение
сосущий 0-3 недели
отъем / стартер 3-8 недель
производитель 8-12 недель
откорма 6
Срок
Определение
Срок
Свиньи, критерии отбора для вязки
Определение
Скорость прироста, экстерьер, количество сосков (должны быть в состоянии прокормить не менее 10 потомков)
Срок
Свинья: беременность
Определение
Срок
Определение
генетическое улучшение, снижение риска ИППП, синхронизация
Срок
свиньи: клетки для оплодотворения
Cal Prop 2
Определение
плюсы: предотвращает драки, экономика
минусы: ограничение нормального поведения, пролежни, проблемы с суставами
Срок
Определение
-предотвращение раздавливания поросят- причина смерти поросят №1 у поросят
-содержание поросят в тепле- сосунки имеют низкие запасы жира / гликогена и склонны к гипогикемии
Срок
свиньи: средняя смертность до отъема
Определение
Срок действия
Стартер для поросят / подпитка
Определение
Пеллетный рацион на основе сухого молока, используемый как при отъеме от грудных детей
Срок
Определение
-3 недели
-Поросята «массово отлучены» => синхронизируют свиноматок
- кормят стартером / ползуном (сухая сыворотка) в течение первых 1-2 недель
- затем кормят кукурузным / соевым шротом
- средний прирост 0.75 фунтов / день

- смертность в этом возрасте 2-2,5%

Срок
свиней: ферма, завершающая операция
Определение
- свиньи переехали в 8 недель
- выращивание 8-12 недель
- плавник 12 недель - 5,5 / 6 месяцев (по достижении рыночного веса)
- низкая смертность на этих этапах жизни
Срок
Целевой привес для производственных свиней
Определение
Срок
Целевой привес для производственных свиней
Определение
Срок
Свиньи: программы all-in / all out
Определение
- синхронизация течки
все поросята, отлученные от груди через 3–4 недели
свиноматок возвращаются к охоте через 3 дня
размножаются на 1 и 3 день охоты
- используйте PGF2a, чтобы вызвать за 36 часов до опороса => весь опорос в тот же день
- иммунизация за 1 неделю до опороса
- высокий уровень биобезопасности
Срок
vax для свиноматок / маток до опороса
Определение
парво, рожа, ротавирус, коронавирус и, возможно, TGE
Срок
свиньи: от опороса до опороса / «проточная система»
Определение
-все стадии / полы свиней
-проблема: ТРАНСМИССИЯ DX
Срок
Определение
- свиноматки и кабаны для разведения
- поросята от рождения до питомника, затем проданные
Срок
свиней: выращивание / завершение операции
Определение
- свиньи от стадии выращивания до рынка
Срок
Определение
переносит поросят из питомника на стадию откорма
Срок
Определение
без специфических патогенов
- высокая биозащита
- душ, душ
- без ввоза посторонних свиней
- для получения SPF свиней - индуцирует у свиноматок, кесарево сечение, поросята, выращенные в среде, свободной от патогенов
-Свиньи SPF будут очень восприимчивы к патогенам в среде без SPF => должны быть вакцинированы до заражения
Срок
свиньи: Рактомфамин (PayLean)
Определение
-повышает скорость роста и эффективность корма
-В адренергический агонист
-добавляется за 4-5 недель до убоя
-разрешено только для маркерных свиней
-производители могут злоупотреблять
Срок
Свинья: вопросы безопасности пищевых продуктов
Определение
trichonella spiralis
E.Coli 01H57
Salmonella
Аскариды
Срок
свиньи: руководство по общей дезинфекции
Определение
- физически очистить весь органический материал
- удалить 4 в верхнем слое почвы
- слить стоячую воду
- удалить ворота, питатели, ограждения и т. Д. И промыть водой с моющим средством
- очистить оборудование для обработки навоза
- нанести дезинфицирующее средство
- выдержать время контакта
- высохнуть и оставаться пустым не менее 3 дней
Срок
Определение
щелочной формальдегид для спороцитов
щелочь, амония для криптоспоридий
Фенолы для лечения туберкулеза и Джонса
Срок
Определение
Т-100.4-102.2
П-60-90
Р-10-20
Срок
свиньи: Показатели жизнедеятельности поросят
Определение
.

Смотрите также

От вздутия живота народные средства

От Вздутия Живота Народные Средства

Народные средства от вздутия живота Вздутие живота или метеоризм характеризуется излишним скоплением газов в кишечнике, которое может вызывать болезненные… Подробнее...
Заболевания вызывающие тошноту, диарею и повышенную температуру тела

Температура Понос Тошнота

Заболевания вызывающие тошноту, диарею и повышенную температуру тела Каждый хоть однажды сталкивался с такими неприятными симптомами, как температура, понос,… Подробнее...
Почему у ребенка зеленый понос

Понос Зеленый У Ребенка

Почему у ребенка зеленый понос Появление у ребенка зеленого поноса часто вводит в панику его родителей. Не зная причину появления поноса зеленого цвета, в… Подробнее...
Какие болезни сопровождаются поносом и рвотой

Температура Понос Рвота У Ребенка

Какие болезни сопровождаются поносом и рвотой У маленького ребенка еще только формируется защитная система организма, и… Подробнее...
Лекарство от вздутия живота

Лекарство От Вздутия Живота

Чем снять вздутие живота Вздутие живота, как его называют врачи, метеоризм, — неприятная, а главное, исключительно… Подробнее...
Причины поноса после еды

После Еды Сразу Иду В Туалет По Большому - Понос

Причины поноса после еды Некоторый жалуются, что после еды сразу идут в туалет по-большому из-за поноса. Такая… Подробнее...
Понос после арбуза

Понос После Арбуза

Какие продукты могут вызвать понос Расстройство пищеварения может возникнуть не только как реакция на отравление, но и… Подробнее...
Первая помощь ребенку при рвоте

Рвота У Ребенка Без Температуры И Поноса Что Делать - 3 Года

Первая помощь ребенку при рвоте Дети до 5 лет являются самой восприимчивой к различным вирусам и бактериям группой.… Подробнее...